| Antibodies |
| α-Tubulin |
Sigma-Aldrich, mouse clone DM1A (1:3000 IF) |
Cat#T6199 RRID: AB_477583, lot 078M5796V |
| α-Tubulin |
Abcam, rabbit clone EP1322Y (1:500 IF) |
Cat#ab52866, RRID: AB_869989, lot GR3241238-2 |
| α-Tubulin (HRP-conjugated) |
Abcam, mouse clone DM1A (1:5000 WB) |
Cat#ab40742, RRID: AB_880625, lot GR3229214-1 |
| β-Tubulin |
Sigma Aldrich, mouse clone Tub2.1 (1:500 Oocyte IF) |
Cat#T4026 RRID: AB_477577 |
| GFP |
Roche, mouse clones 13.1 and 7.1 (1:1000 WB) |
Cat#11814460001, RRID: AB_390913, lot 14442000 |
| mNeonGreen |
Chromotek, mouse clone 32F6 (1:1000 WB) |
Cat#32F6, RRID: AB_2827566, lot 71108021 |
| Anti-centromere (ACA) |
Antibodies Inc, human polyclonal (1:100 IF) |
Cat#15234, RRID: AB_2687472, lot 1CK37 |
| CENP-A |
Abcam, mouse clone 3–19 (1:1000 IF) |
Cat#ab13939, RRID: AB_300766, lot GR3265183-3 |
| Mouse CENP-A |
Cell Signaling Tech, rabbit clone C51A7 (1:200 oocyte IF) |
Cat#2048S, RRID: AB_1147629 |
| CENP-C |
Cheeseman lab (Gascoigne et al., 2011), rabbit polyclonal (1 μg/mL IF) |
pBB280 |
| Mouse CENP-C |
Cheeseman lab (Swartz et al., 2019), rabbit polyclonal (1:1000 oocyte IF) |
pKG137 |
| pS311 CENP-C |
Cheeseman lab, this study, rabbit polyclonal (1 μg/mL IF) |
85B |
| Plk1 |
Santa Cruz Biotech, mouse clone F8 (1:200 IF, WB) |
Cat#sc17783, RRID: AB_628157, lot D1219 |
| Plk1 |
Sigma Aldrich, mouse clone 35–206 (1:200 oocyte IF) |
Cat#05-844, RRID: AB_310836 |
| Ndc80 “Bonsai” complex |
Cheeseman lab (Schmidt et al., 2012), rabbit polyclonal (1 μg/mL IF) |
Anti-Bonsai |
| Hec1 |
Santa Cruz Biotech, mouse clone C11 (1:100 oocyte IF) |
Cat#sc515550 |
| Mouse Bub1 |
Gift of Yoshinori Watanabe (U Tokyo) (Kawashima et al., 2010), mouse polyclonal (1:100 oocyte IF) |
Anti-mouse Bub1 |
| Separase |
Abcam, mouse clone XJ11-1B12 (1:500 WB) |
Cat#ab16170, RRID: AB_2101815, lot GR44153-1 |
| Cyclin B1 |
Cell Signaling Tech, rabbit polyclonal (1:1000 WB) |
Cat#4138, RRID: AB_2072132, lot 3 |
| Histone 3 pS10 |
Abcam, rabbit polyclonal (1:3000 FC) |
Cat#ab5176, RRID: AB_304763, lot GR3217296-1 |
| GFP polyclonal |
Cheeseman lab, rabbit (IP) (Cheeseman and Desai, 2005) |
Rabbit GFP polyclonal |
|
|
|
| Bacterial and Virus Strains |
|
E coli: LOBSTR-BL21 (DE3)-RIL |
Kerafast (Andersen et al., 2013) |
Cat#EC1002 |
|
|
|
| Chemicals, Peptides, and Recombinant Proteins |
| Doxycycline |
Sigma-Aldrich |
Cat#D9891, CAS:24390-14-5 |
| S-trityl-L-cysteine (STLC) |
Sigma-Aldrich |
Cat#164739, CAS:2799-07-7 |
| Nocodazole |
Sigma-Aldrich |
Cat#M1404, CAS:31430-18-9 |
| AZ-3146 (Mps1i) |
Tocris |
Cat#3994, CAS:1124329-14-1 |
| BI-2536 (Plk1i) |
Fisher Scientific |
Cat#508733, CAS:755038-02-9 |
| RO-3306 (Cdk1i) |
Sigma-Aldrich |
Cat#SML0569, CAS:872573-93-8 |
| Lambda Protein Phosphatase |
New England Biolabs |
Cat#P0753 |
| Milrinone |
Sigma-Aldrich |
Cat#M4659 |
|
|
|
| GST-hCENP-C (700–943) |
This study |
pKM138 |
| GST-hCENP-C (808–943) |
This study |
pNM221 |
| GST-hCENP-C (775–943, 835–838A) |
This study |
pNM232 |
| GST-hCENP-C (775–943, 865–867A) |
This study |
pNM271 |
| GST-sfGFP-hMeikin (328–373) *GST tag removed during purification |
This study |
pNM190 |
| GST-sfGFP-hMeikin (328–373, ICCII/DIII mutant) *GST tag removed during purification |
This study |
pNM201 |
| GST-sfGFP-hMeikin (302–373) *GST tag removed during purification |
This study |
pNM175 |
|
|
|
| Critical Commercial Assays |
| PhosphoSens Plk1 activity assay |
AssayQuant <assayquant.com> |
Cat#CSKS-AQT0691K |
| T7 mScript Standard mRNA Production System |
CellScript |
Cat#CMSC11610 |
|
|
|
| Deposited Data |
| Original CellProfiler pipelines |
Mendeley Data |
Doi: 10.17632/7gwbym8y9n.1 |
| Mass-spectrometry RAW files |
Mendeley Data |
Doi: 10.17632/7gwbym8y9n.1 |
| Uncropped Western blot images |
Mendeley Data |
Doi: 10.17632/7gwbym8y9n.1 |
|
|
|
| Experimental Models: Cell Lines |
| Human: HeLa cells |
Cheeseman lab stocks |
RRID:CVCL_0030 |
| Human: 293GP cells (for retrovirus generation) |
Cheeseman lab stocks |
RRID:CVCL_E072 |
| Constitutive expression: 2xmNeonGreen-hMeikin |
Hela: Retroviral transduction with pNM481, clonal, this study |
cNM216-7 |
| Constitutive expression: 2xmNeonGreen-hMeikin (328–373) |
Hela: Retroviral transduction with pNM512, clonal, this study |
cNM239-14 |
| Constitutive expression: 2xmNeonGreen-hMeikin (1–332) |
Hela: Retroviral transduction with pNM513, clonal, this study |
cNM240-4 |
| Constitutive expression: 2xmNeonGreen-hMeikin (ICCII/DIII mutant) |
Hela: Retroviral transduction with pNM511, clonal, this study |
cNM238-3 |
| Constitutive expression: hMeikin-mNeonGreen |
Hela: Retroviral transduction with pNM795, clonal, this study |
cNM396-15 |
| Doxycycline inducible: EGFP |
Hela: AAVS1 Safe-harbor insertion of pNM280, this study |
cNM087 |
| Doxycycline inducible: EGFP-hMeikin |
Hela: AAVS1 Safe-harbor insertion of pNM299, this study |
cNM102 |
| Doxycycline inducible: EGFP-hMeikin (104–373) |
Hela: AAVS1 Safe-harbor insertion of pNM480, this study |
cNM220 |
| Doxycycline inducible: EGFP-hMeikin (124–373) |
Hela: AAVS1 Safe-harbor insertion of pNM549, this study |
cNM244 |
| Doxycycline inducible: EGFP-hMeikin (155–373) |
Hela: AAVS1 Safe-harbor insertion of pNM603, this study |
cNM271 |
| Doxycycline inducible: EGFP-hMeikin (184–373) |
Hela: AAVS1 Safe-harbor insertion of pNM335, this study |
cNM142 |
| Doxycycline inducible: EGFP-hMeikin (199–373) |
Hela: AAVS1 Safe-harbor insertion of pNM336, this study |
cNM143 |
| Doxycycline inducible: EGFP-hMeikin (227–373) |
Hela: AAVS1 Safe-harbor insertion of pNM325, this study |
cNM134 |
| Doxycycline inducible: EGFP-hMeikin (1–332) |
Hela: AAVS1 Safe-harbor insertion of pNM310, this study |
cNM123 |
| Doxycycline inducible: EGFP-hMeikin (1–310) |
Hela: AAVS1 Safe-harbor insertion of pNM338, this study |
cNM145 |
| Doxycycline inducible: EGFP-hMeikin (1–301) |
Hela: AAVS1 Safe-harbor insertion of pNM311, this study |
cNM124 |
| Doxycycline inducible: EGFP-hMeikin (1–226) |
Hela: AAVS1 Safe-harbor insertion of pNM502, this study |
cNM226 |
| Doxycycline inducible: EGFP-hMeikin (1–154) |
Hela: AAVS1 Safe-harbor insertion of pNM680, this study |
cNM311 |
| Doxycycline inducible: EGFP-hMeikin (124–332) |
Hela: AAVS1 Safe-harbor insertion of pNM611, this study |
cNM273 |
| Doxycycline inducible: EGFP-hMeikin (175–181 4A mut) |
Hela: AAVS1 Safe-harbor insertion of pNM400, this study |
cNM172 |
| Doxycycline inducible: EGFP-hMeikin (S196A) |
Hela: AAVS1 Safe-harbor insertion of pNM398, this study |
cNM170 |
| Doxycycline inducible: EGFP-hMeikin (STP mutant) |
Hela: AAVS1 Safe-harbor insertion of pNM300, this study |
cNM119 |
| Doxycycline inducible: EGFP-hMeikin (8A mutant) |
Hela: AAVS1 Safe-harbor insertion of pNM604, this study |
cNM272 |
| Doxycycline inducible: EGFP-hMeikin (E151R, R154E) |
Hela: AAVS1 Safe-harbor insertion of pNM726, this study |
cNM321 |
| Doxycycline inducible: EGFP-hMeikin (1–332)-H2B |
Hela: AAVS1 Safe-harbor insertion of pNM801, this study |
cNM371 |
| Doxycycline inducible: EGFP-hMeikin (1–154)-H2B |
Hela: AAVS1 Safe-harbor insertion of pNM888, this study |
cNM469 |
| Doxycycline inducible: EGFP-hMeikin (155–332)-H2B |
Hela: AAVS1 Safe-harbor insertion of pNM802, this study |
cNM366 |
| Doxycycline inducible: EGFP-hMeikin (1–332, STP mutant)-H2B |
Hela: AAVS1 Safe-harbor insertion of pNM804, this study |
cNM370 |
| Doxycycline inducible: EGFP-hMeikin (1–332, 8A mut)-H2B |
Hela: AAVS1 Safe-harbor insertion of pNM803, this study |
cNM372 |
| Doxycycline inducible: EGFP-hPlk1 |
Hela: AAVS1 Safe-harbor insertion of pNM364, this study |
cNM161 |
| Constitutive expression: H2B-mScarlet-hMeikin(1–332)-mNeonGreen |
Hela: Retroviral transduction with pNM848, fluorescence enriched, this study |
cNM426e |
| Constitutive expression: H2B-mScarlet-hMeikin(1–332, E151R, R154E)-mNeonGreen |
Hela: Retroviral transduction with pNM849, fluorescence enriched, this study |
cNM427e |
| Constitutive expression: H2B-mScarlet-hMeikin(1–332, S149A)-mNeonGreen |
Hela: Retroviral transduction with pNM850, fluorescence enriched, this study |
cNM428e |
| Constitutive expression: H2B-mScarlet-hMeikin(1–332, 8A mut)-mNeonGreen |
Hela: Retroviral transduction with pNM852, fluorescence enriched, this study |
cNM430e |
| Constitutive expression: H2B-mScarlet-hRad21(142–476)-mNeonGreen |
Hela: Retroviral transduction with pNM853, fluorescence enriched, this study |
cNM431e |
| Constitutive expression: H2B-mScarlet-hRad21(142–476, E169R, R172E, E447R, R450E, E457R, R460E)-mNeonGreen |
Hela: Retroviral transduction with pNM854, fluorescence enriched, this study |
cNM432e |
| Constitutive expression: H2B-mScarlet-hRec8(297–506)-mNeonGreen |
Hela: Retroviral transduction with pNM937, fluorescence enriched, this study |
cNM478e |
| Constitutive expression: H2B-mScarlet-hRec8(297–506)-hMeikin(1–332, E151R, R154E)-mNeonGreen |
Hela: Retroviral transduction with pNM869, fluorescence enriched, this study |
cNM486e |
| Constitutive expression: H2B-mScarlet-hRec8(297–506, E401R, R404E)-hMeikin(1–332, E151R, R154E)-mNeonGreen |
Hela: Retroviral transduction with pNM972, fluorescence enriched, this study |
cNM500e |
| Constitutive expression: H2B-mScarlet-hRec8(297–506)-hMeikin(155–332)-mNeonGreen |
Hela: Retroviral transduction with pNM870, fluorescence enriched, this study |
cNM487e |
| Constitutive expression: H2B-mScarlet-hRec8(297–506)-hMeikin(1–332, E151R, R154E, 8A mut)-mNeonGreen |
Hela: Retroviral transduction with pNM946, fluorescence enriched, this study |
cNM493e |
|
|
|
| Experimental Models: Organisms/Strains |
| Mouse: NSA(CF-1) |
Envigo |
N/A |
|
|
|
| Oligonucleotides |
| siRNA targeting ESPL1: GCUUGUGAUGCCAUCCUGAUU |
Dharmacon (Waizenegger et al., 2002) |
N/A |
| siRNA control pool |
Dharmacon |
Cat#D-001810-10 |
| Primers used for plasmid cloning |
Eurofins Genomics |
See Table S2
|
|
|
|
| Recombinant DNA |
| 3xEGFP-mMeikin |
This study (for oocyte injection) |
pNM530 |
| 3xEGFP-mMeikin (E156R, R159E) |
This study (for oocyte injection) |
pNM606 |
| 3xEGFP-mMeikin(1–391, E156R, R159E) - hRad21(142–275) - mMeikin(387–434) |
This study (for oocyte injection) |
pNM962 |
| 3xEGFP-mMeikin(1–391) - hRad21(142–275, E169R, R172E) - mMeikin(387–434) |
This study (for oocyte injection) |
pNM963 |
| mMeikin-3xEGFP |
This study (for oocyte injection) |
pNM739 |
| mMeikin-3xEGFP (L377A, E379A, N383A) |
This study (for oocyte injection) |
pNM1051 |
| mMeikin-3xEGFP (S381A) |
This study (for oocyte injection) |
pNM1089 |
| mNeonGreen-mMeikin |
This study (for oocyte injection) |
pNM474 |
| mNeonGreen-mMeikin (387–434) |
This study (for oocyte injection) |
pNM477 |
| mNeonGreen-mMeikin (392ICCII, 425DII → 392AAAAA, 425AAA) |
This study (for oocyte injection) |
pNM476 |
| mNeonGreen-mMeikin (T335A) |
This study (for oocyte injection) |
pNM475 |
|
|
|
| Software and Algorithms |
| Fiji (ImageJ) |
NIH (Schindelin et al., 2012) |
2.0.0-rc-69/1.52p |
| CellProfiler |
Broad Institute (McQuin et al., 2018) |
v3.1.9 |
| Graphpad Prism |
Graphpad Software |
v8.4.3 |
| ProteomeDiscoverer |
ThermoFisher |
v2.4 |
| FACSDiva |
BD Biosciences |
v6.1.2 |
