KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal anti-cMyc | Cell Signaling Technology | Cat#15605, RRID:AB_1903938 |
| Rabbit polyclonal anti-S6K1 | Cell Signaling Technology | Cat#2708; RRID: AB_390722 |
| Rabbit monoclonal anti-pS6(S240/S244) | Cell Signaling Technology | Cat#5364; RRID: AB_10694233 |
| Rabbit monoclonal anti-mTOR | Cell Signaling Technology | Cat#5048, RRID:AB_10828101 |
| Rabbit monoclonal anti-Raptor | Cell Signaling Technology | Cat#2280, RRID:AB_561245 |
| Rabbit polyclonal anti-Rictor | Cell Signaling Technology | Cat#9476, RRID:AB_10612959 |
| Rabbit anti-eIF4A1 | Cell Signaling Technology | Cat#2490, RRID:AB_823487 |
| Rabbit anti-eIF4B | Cell Signaling Technology | Cat#3592, RRID:AB_2293388 |
| Rabbit monoclonal anti-TSC2 | Cell Signaling Technology | Cat#4308, RRID:AB_10547134 |
| Rabbit polyclonal anti-METTL3 | Proteintech | Cat#15073–1-AP, RRID:AB_2142033 |
| mouse monoclonal anti-Vinculin | Sigma-Aldrich | Cat#V9264; RRID: AB_10603627 |
| Rabbit polyclonal anti-METTL14 | Sigma-Aldrich | Cat#HPA038002, RRID:AB_10672401 |
| Rabbit polyclonal anti-MXD2 | Sigma-Aldrich | Cat#HPA035319, RRID:AB_10670588 |
| Mouse monoclonal anti-WTAP | Proteintech | Cat#60188–1-Ig, RRID:AB_10859484 |
| Rabbit anti-WTAP | Abcam | Cat#ab195380, RRID:AB_2868572 |
| Rabbit anti-WTAP | Novus | Cat#NBP1–83040, RRID:AB_11041336 |
| Rabbit polyclonal anti-S6K2 | Gene Tex | Cat#GTX101886, RRID:AB_1951783 |
| Mouse monoclonal anti-HA | Santa Cruz Biotechnology | Cat#sc-7392, RRID:AB_627809 |
| Rabbit polyclonal anti-cMyc (ChIP) | Cell Signaling Technology | Cat#9402, RRID:AB_2151827 |
| Rabbit polyclonal anti-MAX | Bethyl | Cat#A302–866A, RRID:AB_10634559 |
| Rabbit polyclonal Anti-N6-methyladenosine (m6A) antibody | Abcam | Cat#ab151230, RRID:AB_2753144 |
| Rabbit Normal IgG | Cell Signaling Technology | Cat#2729, RRID:AB_1031062 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Anti-Flag agarose affinity gel | Sigma-Aldrich | Cat#A2220 |
| Rapamycin | Calbiochem | Cat#553210 |
| Rapamycin | LC Laboratories | Cat#R-5000 |
| PF4708671 | Sigma-Aldrich | Cat#PZ0143 |
| Torin1 | Tocris Bioscience | Cat#4247 |
| Actinomycin D | Sigma-Aldrich | Cat#A1410 |
| RNase inhibitor | Invitrogen | Cat#10777019 |
| Anti-V5 agarose affinity gel | Sigma-Aldrich | Cat#A7345 |
| Lipofectamine RNAiMAX Transfection Reagent | Invitrogen | Cat#13778075 |
| Lipofectamine 3000 reagent | Invitrogen | Cat#L3000015 |
| DNase I | Sigma-Aldrich | Cat#AMPD1 |
| [γ−32P]-ATP | Perkin Elmer | Cat#NEG035C001MC |
| RNA Fragmentation Reagents | Thermo Fisher Scientific | Cat#AM8740 |
| T4 Polynucleotide Kinase | New England Biolabs | Cat#M0201S |
| Apyrase | New England Biolabs | Cat#M0398L |
| TRIzol | Invitrogen | Cat#15596018 |
| Protein A/G magnetic beads | Thermo Fisher Scientific | Cat#88802 |
| Proteinase K | New England Biolabs | Cat#P8107 |
| Lipofectamine 2000 reagent | Invitrogen | Cat#11668500 |
| NuPAGE 4–12% Bis Tris Protein Gels | Thermo Fisher Scientific | Cat#NP0321BOX |
| Phenol:Chloroform:IAA, 25:24:1, pH 6.6 | Thermo Fisher Scientific | Cat#AM9730 |
| SuperScript IV Reverse Transcriptase | Invitrogen | Cat#18090010 |
| Circligase I | Lucigen | Cat#CL4111K |
| AMPure XP for PCR Purification | Beckman Coulter | Cat#A63880 |
| Nuclease P1 from Penicillium citrinum | Sigma-Aldrich | Cat#N8630–1VL |
| Phosphatase, Alkaline from Escherichia coli | Sigma-Aldrich | Cat#P5931–100UN |
| TLC PEI Cellulose F | Merck-Millipore | Cat#105725 |
| Silvestrol | Cheme scene | Cat#CS-0543 |
| Insulin solution human | Sigma-Aldrich | Cat#I9278 |
| Crystal Violet | Sigma-Aldrich | Cat#C3886 |
| Oligo d(T)25 Magnetic Beads | New England Biolabs | Cat#S1419S |
| Dynabeads Oligo(dT)25 | Invitrogen | Cat#61005 |
| 10% neutral buffered formalin | RICCA Chemical | Cat#3190–1 |
| Methanol-free 10% formaldehyde | Polysciences | Cat#04018–1 |
| Cycloheximide | Sigma-Aldrich | Cat#C4859 |
| Critical Commercial Assays | ||
| PureLink RNA Mini kit | Ambion | Cat#12183018A |
| iScript cDNA synthesis kit | Bio-rad | Cat#170–8891BUN |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat#4368814 |
| KAPA HiFi HotStart Library Amplification Kit Illumina Platforms | Kapa Biosystems | Cat#KR0408 |
| Gateway LR clonase II enzyme mix | Invitrogen | Cat#11791 |
| QuickChange site-directed mutagenesis kit | Strategene | Cat#200521 |
| RNA Clean & Concentrator | Zymo Research | Cat#R1016 |
| Click-it Nascent RNA Capture Kit | Thermo Fisher Scientific | Cat#C10365 |
| ChIP-IT Express Kit | Active Motif | Cat#53009 |
| Chromatin IP DNA purification kit | Active Motif | Cat#58002 |
| SYBR Green PCR Master Mix | Life Technologies | Cat#4312704 |
| TuRboCapture 96 mRNA Kit | Qiagen | Cat#72251 |
| Deposited Data | ||
| Raw miCLIP data | This paper | GSE152633 |
| Raw data of Images and WB | This paper | http://dx.doi.org/10.17632/7sgjcvjpt9.1 |
| Experimental Models: Cell Lines | ||
| Human: Renal angiomyolipoma-derived LAM 621–101 (TSC2−/−) | Drs. Jane Yu and Elizabeth Henske | Yu et al., 2004 |
| Human: HEK293E | ATCC | Cat#293 c18; RRID: CVCL_6974 |
| Human: HEK293T | GenHunter | Cat#Q401 |
| Human: MCF7 | ATCC | Cat#HTB-22; RRID: CVCL_0031 |
| Human: DLD1 | ATCC | Cat#CCL-221; RRID: CVCL_0248 |
| Human: NCI-H1299 | ATCC | Cat#CRL-5803, RRID: CVCL_0060 |
| Human: BT549 | ATCC | Cat#HTB-122, RRID:CVCL_1092 |
| Experimental Models: Organisms/Strains | ||
| Male Tsc2tm1Djk/+ mice (A/J strain) | Tuberous Sclerosis Alliance and Van Andel Institute | Onda et al., 1999 |
| Male wild type A/J strain mice | Jackson Laboratory | Cat#000646 |
| Oligonucleotides | ||
| pLKO.1-puro-Non-Mammalian shRNA Control | Sigma-Aldrich | SHC002 |
| pLKO.1-puro-shWTAP-#1(Human) | Sigma-Aldrich | TRCN0000231426 |
| pLKO.1-puro-shWTAP-#2(Human) | Sigma-Aldrich | TRCN0000001074 |
| pLKO.1-puro-shWTAP-#3(Human) | Sigma-Aldrich | TRCN0000231422 |
| sgRNA targeting sequence (Human WTAP): CTGACAAACGGACCAAGTAA | This paper | N/A |
| Primers for qPCR analysis, see Table S3 | This paper | N/A |
| siRNAs list, see Table S4 | This paper | N/A |
| Recombinant DNA | ||
| pcDNA3-Flag-METTL3 | Addgene | Cat#53739 |
| pcDNA3-Flag-METTL14 | Addgene | Cat#53740 |
| pCDNA3-HA-human cMYC | Addgene | Cat#74164 |
| Lentiviral packaging and envelope plasmids | Dr. David Baltimore | N/A |
| pcDNA3-EGFP | Addgene | Cat#13031 |
| pDONR223-MAX-WT-V5 | Addgene | Cat#82944 |
| pcDNA3-MXD2 | Dr. AlmutSchulze | Delpuech et al., 2007 |
| lentiCRISPRv2 vector | Dr. Feng Zhang | Sanjana et al., 2014 |
| pKH3-S6K1-F5A/T389E/R3A | Dr. John Blenis | Schalm et al., 2005 |
| pENTR-WTAP(5’UTR+CDS) | This paper | N/A |
| pcDNA3-Flag-WTAP(CDS) | Addgene | Cat#53741 |
| pcDNA3-METTL3-D395A/W398A | This paper | N/A |
| pcDNA3-MXD2-C882T(m6A site mutant) | This paper | N/A |
| Software and Algorithms | ||
| FLEXBAR | Dodt et. al., 2012 | https://github.com/seqan/flexbar/wiki |
| MEME-ChIP de novo motif search | Machanick and Bailey 2011 | https://www.ncbi.nlm.nih.gov/pubmed/21486936 |
| CTK package | Shah et al., 2017 | https://github.com/chaolinzhanglab/ctk |
| BEDTools | Quinlan and Hall, 2010 | https://github.com/arq5x/bedtools2 |
| Adobe Photoshop | Adobe | Adobe |
| Odyssey imaging system | LI-COR Biosciences | LI-COR Biosciences |
| pyCRAC.py | Webb et al., 2014 | https://git.ecdf.ed.ac.uk/sgrannem/pycrac |
| DAVID | Open source | http://david.abcc.ncifcrf.gov/ |
| Other | ||
| Mass spectrometry | Dr. Joshua Rabinowitz and Dr. Cholsoon Jang | N/A |
| MRI imaging (9.4T 20-cm bore Bruker Biospec scanners) | Memorial Sloan Kettering Cancer Center | N/A |