TABLE 4.
CBSa | Bound by WT | Bound by V301A | cre | cre locationb | cre sequence | Locus tagc | Gene | Annotation | COG | Regulated by CcpA | HPr‐dependency |
---|---|---|---|---|---|---|---|---|---|---|---|
1 | Yes | Yes | Yes | Prom | AAAGAAAGCGGTTTCA | M5005_Spy_0039 | adh2 | Bifunctional acetaldehyde‐CoA/alcohol dehydrogenase | C | Yes | Semi dependent |
2 | Yes | Yes | Yes | Prom | ACAGAAAACGATTTCA | M5005_Spy_0094 | ackA | Acetate kinase | F | Yes | Independent |
3 | Yes | No | Yes | ORF | ATGGTGGCGTTTTCTT | M5005_Spy_0128 | ntpE | V‐type ATP synthase subunit E | C | Yes | Independent |
4 | Yes | Yes | Yes | Prom | AACGAAAACCTTTTCA | M5005_Spy_0180 | – | Hypothetical protein | D | No | NA |
4 | Yes | Yes | Yes | Prom | AACGAAAACCTTTTCA | M5005_Spy_0185 | pgi | pgi | G | No | NA |
5 | Yes | No | Yes | Prom | TTGAAAGCGCTTTATT | M5005_Spy_0212 | – | N‐acetylmannosamine‐6‐phosphate 2‐epimerase | G | Yes | Independent |
6 | Yes | Yes | Yes | Prom | AAAGAAAGCCCTTTCC | M5005_Spy_0233 | plr | Aldehyde dehydrogenase | G | No | NA |
7 | Yes | Yes | Yes | Prom | AATGTAAGCGCTAACAAAAT | M5005_Spy_0339 | exoA | Exodeoxyribonuclease | L | Yes | Independent |
7 | Yes | Yes | Yes | Prom | AATGTAAGCGCTAACAAAAT | M5005_Spy_0340 | lctO | L‐lactate oxidase | C | Yes | Semi dependent |
8 | Yes | Yes | Yes | ORF | TAGGAAGCGTTTTCTT | M5005_Spy_0341 | prtS | Peptidase S8 | O | Yes | Independent |
9 | Yes | No | Yes | ORF | GTGCAAGCGCTTTGAT | M5005_Spy_0362 | gcaD | Glucosamine‐1‐phosphate acetyltransferase | M | No | NA |
10 | Yes | No | No | – | – | M5005_Spy_0416 | Glutamine cyclotransferase | O | No | NA | |
10 | Yes | No | No | – | – | M5005_Spy_0417 | pcp | Pyrrolidone‐carboxylate peptidase | O | No | NA |
11 | Yes | No | No | – | – | M5005_Spy_0417 | pcp | Pyrrolidone‐carboxylate peptidase | O | No | NA |
12 | Yes | No | Yes | Prom | TTGAAAACTTTTTCAA | M5005_Spy_0424 | ccpA | Catabolite control protein A | K | Yes | Independent |
13 | Yes | No | No | – | – | M5005_Spy_0495 | lysS | Lysine‐‐tRNA ligase | J | No | NA |
13 | Yes | No | No | – | – | M5005_Spy_0496 | Haloacid dehalogenase | S | No | NA | |
14 | Yes | No | No | – | – | M5005_Spy_0504 | pepF | Oligoendopeptidase F | E | No | NA |
15 | Yes | Yes | Yes | ORF | TTTGGGAACGATTTCTCAAG | M5005_Spy_0771 | – | CRISPR‐associated endonuclease Cas2 | L | No | NA |
16 | Yes | Yes | Yes | Prom | AAATAAAGCGCTTACT | M5005_Spy_0505 | ppc | Phosphoenolpyruvate carboxylase | H | Yes | Fully dependent |
17 | Yes | Yes | Yes | Prom | GAGAAAACGTTTTAGT | M5005_Spy_0512 | – | Sugar phosphate phosphatase | S | Yes | Fully dependent |
18 | Yes | No | Yes | Prom | TTGACACCGTTTTCAT | M5005_Spy_0533 | – | Hypothetical protein | S | Yes | Independent |
18 | Yes | No | Yes | Prom | TTGACACCGTTTTCAT | M5005_Spy_0534 | – | Acetoin reductase | IQ | Yes | Semi dependent |
19 | Yes | No | Yes | ORF | GAAGATATCGCTTCTA | M5005_Spy_0556 | eno | Phosphopyruvate hydratase | F | No | NA |
20 | Yes | No | Yes | Prom | TATTATATCGATTTCT | M5005_Spy_0555 | – | Hypothetical protein | S | No | NA |
20 | Yes | No | Yes | Prom | TATTATATCGATTTCT | M5005_Spy_0556 | eno | Phosphopyruvate hydratase | F | No | NA |
21 | Yes | Yes | Yes | Prom | AAGAAAGGGTTTACAT | M5005_Spy_0562 | sagA | Streptolysin S family bacteriocin | Yes | Semi dependent | |
22 | Yes | No | Yes | ORF | ATGGAAGCTTTTTCAG | M5005_Spy_0622 | – | Alkaline phosphatase | M | No | NA |
22 | Yes | No | Yes | ORF | ATGGAAGCTTTTTCAG | M5005_Spy_0625 | aroF | Chorismate synthase | E | No | NA |
23 | Yes | No | Yes | ORF | GTGAAGGGTTTATCAT | M5005_Spy_0772 | – | Type II‐A CRISPR‐associated protein Csn2 | S | No | NA |
24 | Yes | No | No | – | – | M5005_Spy_0778 | msrB | Peptide‐methionine (R)‐S‐oxide reductase | O | No | NA |
25 | Yes | Yes | Yes | ORF | GAAGATAACGATTTCA | M5005_Spy_0817 | dacA1 | D‐alanyl‐D‐alanine carboxypeptidase | M | No | NA |
26 | Yes | No | Yes | ORF | TTGTAAGCGCTACCGA | M5005_Spy_0823 | folQ | Dihydroneopterin aldolase | H | No | NA |
27 | Yes | Yes | Yes | Prom | AAGAAAGGGTTTTCAA | M5005_Spy_0834 | – | Alcohol dehydrogenase | E | Yes | Semi dependent |
27 | Yes | Yes | Yes | Prom | AAGAAAGGGTTTTCAA | M5005_Spy_0835 | – | Acid phosphatase/phosphotransferase | S | Yes | Semi dependent |
28 | Yes | No | Yes | Prom | ACTGATAACGCTTCCAA | M5005_Spy_0873 | ldh | L‐lactate dehydrogenase | C | No | NA |
28 | Yes | No | Yes | Prom | ACTGATAACGCTTCCAA | M5005_Spy_0874 | gyrA | DNA gyrase subunit A | L | No | NA |
29 | Yes | No | No | – | – | M5005_Spy_0925 | rnhB | Hypothetical protein | F | No | NA |
30 | Yes | Yes | Yes | Prom | CTTGAAACCGCTTGCT | M5005_Spy_0934 | ‐ | Lipoate‐‐protein ligase | H | Yes | Fully dependent |
31 | Yes | No | Yes | Prom | AATGAAAGCGTTTATA | M5005_Spy_0938 | pgmA | Phosphoglucomutase | G | Yes | Semi dependent |
32 | Yes | No | No | – | – | M5005_Spy_0938 | pgmA | Phosphoglucomutase | G | Yes | Semi dependent |
33 | Yes | No | No | – | – | M5005_Spy_0938 | pgmA | Phosphoglucomutase | G | Yes | Semi dependent |
34 | Yes | Yes | Yes | ORF | TAAGATACCGCTTGCA | M5005_Spy_1055 | glgP | Maltodextrin phosphorylase | G | Yes | Independent |
34 | Yes | Yes | Yes | ORF | TAAGATACCGCTTGCA | M5005_Spy_1058 | malE | Maltose/maltodextrin‐binding protein | G | Yes | Independent |
35 | Yes | Yes | Yes | Prom | CTGCAAGCGGTTGCAT | M5005_Spy_1057 | malR | LacI family transcriptional regulator | K | Yes | Independent |
35 | Yes | Yes | Yes | Prom | CTGCAAGCGGTTGCAT | M5005_Spy_1058 | malE | Maltose/maltodextrin‐binding protein | G | Yes | Independent |
36 | Yes | Yes | Yes | Prom | ATCGTAATCGCTTTCA | M5005_Spy_1067 | malX | Sugar ABC transporter substrate‐binding protein | G | Yes | Semi dependent |
37 | Yes | Yes | Yes | Prom | TTAGAAAACGCTTTCT | M5005_Spy_1083 | bglG | Transcription antiterminator BglG | G | Yes | Semi dependent |
38 | Yes | Yes | Yes | ORF | CTAAAAGCGTTTTCTC | M5005_Spy_1096 | – | Thioesterase | Q | No | NA |
39 | Yes | No | Yes | Prom | CATGATAACCCTTACA | M5005_Spy_1122 | nrdH | NrdH‐redoxin | O | Yes | Independent |
39 | Yes | No | Yes | Prom | CATGATAACCCTTACA | M5005_Spy_1121 | ptsH | Phosphocarrier protein HPr | G | Yes | NA |
40 | Yes | Yes | Yes | Prom | CAAGAAATCGCTTTCT | M5005_Spy_1235 | – | Phosphomannomutase | G | Yes | Semi dependent |
41 | Yes | No | Yes | ORF | CAGAAAACTCTTTCTT | M5005_Spy_1250 | ftsA | Cell division protein FtsA | D | No | NA |
42 | Yes | No | Yes | Prom | ATGGAATCGCTTTCTA | M5005_Spy_1258 | – | Hypothetical protein | S | Yes | Independent |
43 | Yes | No | Yes | ORF | ATCGTAAGCGCCTCCA | M5005_Spy_1265 | – | Ribose operon repressor | No | NA | |
44 | Yes | No | Yes | ORF | GTAAAATCTTTTTCTG | M5005_Spy_1272 | – | Arginine:ornithine antiporter | S | Yes | Semi dependent |
45 | Yes | No | No | – | – | M5005_Spy_1274 | N‐acetyltransferase | K | Yes | Semi dependent | |
46 | Yes | No | No | – | – | M5005_Spy_1274 | N‐acetyltransferase | K | Yes | Semi dependent | |
47 | Yes | No | No | – | – | M5005_Spy_1274 | N‐acetyltransferase | K | Yes | Semi dependent | |
48 | Yes | Yes | Yes | Prom | TGAGTAATCGCTTACA | M5005_Spy_1275 | arcA | Arginine deiminase | E | Yes | Semi dependent |
48 | Yes | Yes | Yes | Prom | TGAGTAATCGCTTACA | M5005_Spy_1277 | ahrC.2 | Arginine regulator | K | Yes | Semi dependent |
49 | Yes | Yes | Yes | ORF | CTGCAATCGTTTACTT | M5005_Spy_1319 | – | RNA methyltransferase | J | No | NA |
49 | Yes | Yes | Yes | ORF | CTGCAATCGTTTACTT | M5005_Spy_1323 | – | Hypothetical protein | L | No | NA |
50 | Yes | Yes | Yes | Prom | CTTGAAGCGCTTACTT | M5005_Spy_1328 | – | YigZ family protein | S | Yes | Independent |
50 | Yes | Yes | Yes | Prom | CTTGAAGCGCTTACTT | M5005_Spy_1325 | – | Ribosome‐associated factor Y | J | Yes | Fully dependent |
51 | Yes | No | No | – | – | M5005_Spy_1366 | Penicillin‐binding protein 2X | M | No | NA | |
52 | Yes | Yes | Yes | ORF | GAGAAAAGGATTTCAT | M5005_Spy_1367 | ftsL | Cell division protein FtsL | D | No | NA |
53 | Yes | Yes | Yes | Prom | AAGTAAGCGTTTTCCT | M5005_Spy_1381 | glpK | Glycerol kinase | F | Yes | Independent |
54 | Yes | No | No | – | – | M5005_Spy_1382 | Hypothetical protein | T | Yes | Independent | |
55 | Yes | Yes | Yes | Prom | CTGTAAGCGATTACTT | M5005_Spy_1387 | – | 2,5‐diketo‐D‐gluconic acid reductase | C | Yes | Independent |
56 | Yes | No | No | – | – | M5005_Spy_1448 | Nuclease | S | No | NA | |
57 | Yes | Yes | Yes | Prom | GTGAAAACGTTTTAAA | M5005_Spy_1477 | – | NCS2 family permease | S | Yes | Semi dependent |
57 | Yes | Yes | Yes | Prom | GTGAAAACGTTTTAAA | M5005_Spy_1479 | manL | PTS mannose transporter subunit EIIAB | G | Yes | Semi dependent |
58 | Yes | Yes | Yes | Prom | AAAGAAAACGTTTTCT | M5005_Spy_1496 | phaB | Enoyl‐CoA hydratase | I | Yes | Independent |
59 | Yes | No | No | – | – | M5005_Spy_1497 | dnaJ | Chaperone DnaJ | O | Yes | Fully dependent |
60 | Yes | No | Yes | Prom | AAAGAAAACACTTGCA | M5005_Spy_1503 | – | Histidine phosphatase family protein | G | Yes | Independent |
61 | Yes | No | No | – | – | M5005_Spy_1513 | Aminotransferase | E | No | NA | |
61 | Yes | No | No | – | – | M5005_Spy_1514 | Universal stress protein UspA | T | No | NA | |
62 | Yes | Yes | Yes | Prom | TGGGAAAACGTTTCCT | M5005_Spy_1569 | pfl | Formate acetyltransferase | C | Yes | Independent |
63 | Yes | No | No | – | – | M5005_Spy_1575 | norA | MFS transporter | EGP | Yes | Fully dependent |
64 | Yes | No | Yes | Prom | TTTAAAGCTTTTTAA | M5005_Spy_1599 | pgk | Phosphoglycerate kinase | F | No | NA |
65 | Yes | Yes | Yes | Prom | ATAAAAGCGTTATCTC | M5005_Spy_1624 | – | Hypothetical protein | No | NA | |
66 | Yes | Yes | Yes | ORF | AGAGAAACCGGTACCA | M5005_Spy_1627 | salY | ABC transporter permease | V | No | NA |
67 | Yes | Yes | Yes | Prom | TGCGCAAGCGCTTGCA | M5005_Spy_1680 | pulA | Pullulanase | G | No | NA |
68 | Yes | Yes | Yes | Prom | GATGCAATCGCTTGCA | M5005_Spy_1692 | – | PTS maltose | G | Yes | Independent |
69 | Yes | Yes | Yes | ORF | GTGATAGCGCTATCTT | M5005_Spy_1734 | speB | Streptopain | M | Yes | Independent |
69 | Yes | Yes | Yes | ORF | GTGATAGCGCTATCTT | M5005_Spy_1736 | – | Hypothetical protein | Yes | Independent | |
70 | Yes | No | Yes | Prom | TTGTAATCGTTTACAT | M5005_Spy_1746 | – | PTS cellobiose transporter subunit IIA | G | Yes | Semi dependent |
71 | Yes | No | No | – | – | M5005_Spy_1758 | Dipeptidase | M | Yes | Semi dependent | |
72 | Yes | Yes | Yes | Prom | GTGAAAGCGTTATCGT | M5005_Spy_1758 | – | Dipeptidase | M | Yes | Semi dependent |
73 | Yes | Yes | Yes | Prom | ATGTAAGCGTTATCTAA | M5005_Spy_1772 | – | Glutamate formimidoyltransferase | E | Yes | Independent |
73 | Yes | Yes | Yes | Prom | ATGTAAGCGTTATCTAA | M5005_Spy_1770 | hutI | Imidazolonepropionase | Q | Yes | Semi dependent |
74 | Yes | Yes | Yes | Prom | CATGAAAACGCCTCCA | M5005_Spy_1779 | rpsB | ATP‐binding protein | T | Yes | Semi dependent |
75 | Yes | No | No | – | – | M5005_Spy_1807 | argR2 | Arginine repressor | K | Yes | Independent |
76 | Yes | Yes | Yes | ORF | ACAGATAACGCTTACT | M5005_Spy_1865 | htrA | Serine protease | O | No | NA |
Abbreviation: NA, not applicable.
CcpA binding site number
Prom, binding site located in noncoding promoter region upstream of ATG. ORF, binding site identified within coding region of gene.
Locus tag numbers are based on the MGAS5005 genome.