Skip to main content
. Author manuscript; available in PMC: 2021 Aug 14.
Published in final edited form as: Cell Rep. 2021 Jul 13;36(2):109376. doi: 10.1016/j.celrep.2021.109376

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins
h5MP1 and its 7A and BN1 mutant forms This paper N/A
GST-h5MP1 and its 7A and BN1 mutant forms This paper N/A
GB-heIF3c20-102 This paper N/A
GB- heIF2β53-136 This paper N/A
Critical commercial assays
Dual-Glo® Luciferase Assay System Promega E2940
Nano-Glo® Luciferase Assay System Promega N1110
Deposited data
Raw MS data This paper (Fig. 4AC) JPST001188
Homology model structure of h5MP1 and its docking simulations This paper (Fig. 4D&S7) https://github.com/10ackert/5MP-PIC
Experimental models: Cell lines
Human embryonic kidney (HEK) 293T John A. Chiorini N/A
D. melanogaster cell line S2 Erika Geisbrecht N/A
Experimental models: Organisms/strains
S. cerevisiae S288C: his4-301(ACG) trp1 leu1 ura3 sui1Δ p(sui1-mof2-1 TRP1) (Tang et al., 2017) Asano lab KAY1027
S. cerevisiae S288C: his4-301(ACG) trp1 leu1 ura3 sui1Δ p(sui1- K60E TRP1) This paper Asano lab KAY1121
D. melanogaster: GMR-Gal4, (CGG)90-eGFP BD/Cyo (Jin et al., 2003; Todd et al., 2010) Todd Lab #34
D. melanogaster: UAS-CGG90-eGFP-BD/CyO; Tub5/TM3-Ser line B (Todd et al., 2010) Todd Lab #503
D. melanogaster: y[1] w[1118]; P{w[+mC]=lacW}kra[j9B6]/TM3, Sb[1] Bloomington Drosophila
Stock Center
10216
D. melanogaster: y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02556}attP2 Bloomington Drosophila
Stock Center
27248
D. melanogaster: y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=TRiP.GL00690}attP2 Bloomington Drosophila
Stock Center
38918
D. melanogaster: UAS-d5MP/Cyo BestGene, this paper 28098-1-M3-M-Ch2, Todd Lab #1218
D. melanogaster: UAS-d5MP/Cyo BestGene, this paper 28098-1-M4-M-Ch2, Todd Lab #1219
D. melanogaster: UAS-d5MP/Cyo BestGene, this paper 28098-1-M5-M-Ch2, Todd Lab # 1220
Oligonucleotides
gcGGATCCGAATTCatgtcgcggtttttcaccacc This paper (p1834 & p1835) Asano lab 3c0_N
gcGGATCCGAATTCgaggagctcgtcaccaaac This paper (p1836 & p1837) Asano lab 3c1_N
ccGGATCCctcgctcagcaacaatgg This paper (p1834 & p1836) Asano lab 3c1_C
ggGGATCCgacaccttctttgtccacaatg This paper (p1835 & p1837) Asano lab 3c2_C
gcaatactgcaatggtatcaggaagcacaggttgctcaaggccaa
agtgtttttcttgac
This paper (p1659 & p1818) Asano lab h5MP1-BN1/S
aaaaacactttggccttgagcaacctgtgcttcctgataccattgcagtattgcttcttc This paper (p1659 & p1818) Asano lab h5MP1-BN1/AS
ggagatcatcttgcagtggtaccaggagggccagtcaaaccagggccaaatgcatttcc This paper (p1964) Asano lab Dme5MP-BN1/S
ggaaatgcatttggccctggtttgactggccctcctggtaccactgcaagatgatctcc This paper (p1964) Asano lab Dme5MP-BN1/AS
GtagcggcgagcgcgggcggcggcggtgacggagG This paper (p1785) Asano lab hFMR1_1/S
GATCCctccgtcaccgccgccgcccgcgctcgccgctaCTG
CA
This paper (p1785) Asano lab hFMR1_1/AS
Recombinant DNA
pGEX-h5MP1; GST-fusion to h5MP1 (Singh et al., 2011), (Fig. 1 & S1) Asano lab p1477
pGEX-h5MP1-7A; pGEX-h5MP1 carrying 7A (Singh et al., 2011), (Fig. 1 & S1) Asano lab p1116
pGEX-h5MP1-BN1; pGEX-h5MP1 carrying BN1 This paper (Fig. 1&S1) Asano lab p1818
pGB-heIF2β-K2K3; GB1-fusion to heIF2β53-136 (Luna et al., 2012) (Fig. 1&S1) Asano lab p1336
pGB-heIF3c12-His; GB1-fusion to heIF3c20-102 This paper (Fig. 1&S1) Asano lab p1837
pGB-heIF3c01-His; GB1-fusion to heIF3c1-40 This paper (Fig. S1) Asano lab p1834
pGB-heIF3c02-His; GB1-fusion to heIF3c1-102 This paper (Fig. S1) Asano lab p1835
pGB-heIF3c1-His; GB1-fusion to heIF3c20-40 This paper (Fig. S1) Asano lab p1836
pEF1A-h5MP1; 3xF-h5MP1 under the eEF1A promoter (Kozel et al., 2016) (Fig. 1, 35) Asano lab p1556
pEF1A-h5MP1-BN1; pEF1A-h5MP1carrying
BN1
This paper (Fig. 1, 35) Asano lab p1659
pEF1A-h5MP1-7A; pEF1A-h5MP1carrying 7A (Kozel et al., 2016) (Fig. 35) Asano lab p1667
pEF1A-h5MP2; 3xF-h5MP2 under the eEF1A promoter (Kozel et al., 2016) (Fig. 35) Asano lab p1660
pEF1A-heIF5; 3xF-heIF5 under the eEF1A promoter (Kozel et al., 2016) (Fig. 35) Asano lab p1558
YEpL-TIF5-F; hc TIF5-F LEU2 plasmid (Asano et al., 1999) (Fig. S2) Asano lab p313
YEpL-GB-TIF5B5-F; hc LEU2 plasmid encoding GB1-fusion to yeIF5201-405-F under TIF5 promoter This paper (Fig. 2 & S2) Asano lab p1206
YEpL-GB-TIF5B5 -BN1-F; YEpL-GB-TIF5B5-F carrying BN1 This paper (Fig. 2 & S2) Asano lab p1263
YEpL-h5MP1-F; h5MP1-F LEU2 plasmid (Tang et al., 2017) (Fig. 2 & S2) Asano lab p1587
YEpL-h5MP1-7A-F; hc h5MP1-7A-F LEU2 plasmid Tang et al., 2017) (Fig. 2 & S2) Asano lab p1621
pCDNA-h5MP1; h5MP1 under the CMV promoter (Singh et al., 2011) (Fig. S5) Asano lab p1910
pAC-Dme5MP; Drosophila Kra under the fly actin promoter (Kozel et al., 2016) (Fig. 4) Asano lab p1708
pAC-Dme5MP-BN1; pAc-Dme5MP carrying
BN1
This paper (Fig. 4) Asano lab p1964
pLKO-sh5MP1 0140053 (# 2) (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1462
pLKO-sh5MP1 0139465 (# 5) (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1465
pLKO-sh5MP2 0147346 (# 7) (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1467
pLKO-sh5MP2 0148768 (# 9) (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1469
pLKO-sh5MP2 0147812 (# 10) (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1470
pLKO-shGFP (Kozel et al., 2016) (Fig. 3 & 5) Asano lab p1471
pSV40-firefly Kozak AUG; AUG under a typical Kozak context (Ivanov et al., 2010) (Fig. 3) Asano lab p1523
pSV40-firefly Kozak CUG; CUG under a typical Kozak context (Ivanov et al., 2010) (Fig. 3) Asano lab p1521
pSV40-firefly Kozak GUG; GUG under a typical Kozak context (Ivanov et al., 2010) (Fig. 3) Asano lab p1520
pSV40-firefly Kozak ACG; ACG under a typical Kozak context (Ivanov et al., 2010) (Fig. 3) Asano lab p1525
pSV40-Renilla Kozak AUG; Renilla control plasmid: AUG under a typical Kozak context (Ivanov et al., 2010) (Fig. 3) Asano lab p1526
pSV40 firefly FMR1_24; ACG under FMR1_24 context This paper (Fig. 5E) Asano lab p1785
AUG-nLuc -3xF; AUG-Nluc control plasmid (Kearse et al., 2016) (Fig. 5 & S5) Asano lab p1810
GGG-nLuc -3xF; GGG-Nluc control plasmid (Kearse et al., 2016) (Fig. 5 & S5) Asano lab p1811
+1 (CGG)100-nLuc -3xF; +1 (CGG)100-nLuc -3xF (Kearse et al., 2016) (Fig. 5 & S5) Asano lab p1812
+2 (CGG)100-nLuc -3xF; +2 (CGG)100-nLuc -3xF (Kearse et al., 2016) (Fig. 5 & S5) Asano lab p1813
pGW 5mp-2A-mapple #10 This paper (Fig. S6B) Todd Lab #BG109
pGW 5mp-7a-2A-mapple #10 This paper (Fig. S6B) Todd Lab #BG111
pGW 5MP-BN1-2a-mApple This paper (Fig. S6B) Todd Lab #BG284