Table 2. Sequences of primers, probes, PCR product sizes and amplification efficiency of the qPCR assaysa.
| Organism | Target | Primer and probeb | Primer and probe sequence (5′ to 3′) | nM | Product (bp) | qPCR efficiency (%)c | |
|---|---|---|---|---|---|---|---|
| Singleplex | Multiplex | ||||||
| Mycoplasma sppd | 16S rRNA | Myco_F Myco_R Myco_Probe |
CGAGCGCAACCCTTATCCTT CCCCACTCGTAAGAGGCATGA VIC-TCGTCCCCACCTTCCTCCCG-QSY |
100 100 75 |
118 | 88.8–100.9 | 96.8–102.4 |
| M. bovis | rpoB | M.bovis_F M.bovis_R M.bovis_Probe |
TTTCAGCCGCTAACTTCAGAGC GCAAGTTCCCCATCCTTGAAG ABY-TCGCCTTTAGCAACTTCTTGACCAA-QSY |
200 200 200 |
232 | 87.1 | 95.6 |
| A. laidlawii | ITS | Achol_F Achol_R Achol_Probe |
AAGTGGGCAATACCCAACGC ACGTTCCCGTAGGGATACCTTG 6-FAM-ACGGCTCCCTCCCTTTCGGG-QSY |
15015075 | 108 | 91.9 | 91.2 |
Notes:
The QuantiFast Multiplex PCR master mix (Qiagen, Redwood City, CA, USA) was used for all assays and with an annealing temperature of 58 °C.
F and R indicate forward and reverse primers, respectively. TaqMan probes were designed with 6-FAM (6-carboxyfluorescein) VIC (2’-chloro-7phenyl-1,4-dichloro-6-carboxy-fluorescein) and ABY (Thermo Fisher, Waltham, MA, USA) as reporter dyes on the 5′ end and QSY 7 (QSY7 succinimidyl ester) as the quencher dye on the 3′ end.
Amplification efficiencies were determined using gDNA from M. bovis ATCC25523, M. californicum ATCC 33461, and M. bovigenitalium ATCC19852 (16S rRNA), M. bovis ATCC25523 (rpoB), and A. laidlawii ATCC 23206 (ITS).
The PCR amplification efficiencies for M. bovis, M. californicum ATCC 33461, and M. bovigenitalium ATCC19852 were measured as 88.8%, 97.1%, and 100.9% in singleplex and 96.8, 102.4% and 97.9% in multiplex, respectively.