REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
αCD8, clone 53-6.7 in PerCP-Cy5.5	BD PharMingen	551162
αCD44, clone IM7 in Pacific Blue	Biolegend	103020
αIFNy, clone XMG1.2 in APC	BD PharMingen	554413
αCD107a, clone 1D4B in FITC	BD PharMingen	553793
αCD4, clone RM4-5 FITC	eBioscience	11-0042-82
Bacterial and virus strains
Ad5-SARS-CoV-2 N	A gift from Dr. David Masopust at University of Minnesota	N/A
Ad5-SARS-CoV-2 S	University of Iowa Vector Core, custom made	N/A
SARS-Related Coronavirus 2, Isolate USA-WA1/2020,	BEI resources	NR-52281
Chemicals, peptides, and recombinant proteins
SARS-CoV-2 S protein overlapping peptide pools (181 peptides)	BEI resources	NR-52402
SARS-CoV-2 N protein overlapping peptide pools (59 peptides)	BEI resources	NR-52404
VL8 (VNFNFNGL)	GenScript	N/A
N219 (LALLLLDRL)	GenScript	N/A
SARS CoV-2 S protein for ELISA	Made by the Northwestern University recombinant protein production core using a SARS CoV-2 S protein gene provided by BEI (NR-52394, see above)	N/A
SARS CoV-2 N protein for ELISA	BEI resources	NR-53797
Critical commercial assays
Quick RNA 96 kit (RNA extraction)	Zymo Research	R1052
Taqman RNA-to-CT step kit	ThermoFisher	4392653
Experimental models: Cell lines
HEK293	ATCC	CRL-1573
Vero-E6	ATCC	CRL-1586
Experimental models: Organisms/strains
K18-hACE2 mice	Jackson Laboratories	034060
Recombinant DNA
Plasmid containing SARS CoV-2 spike (S) gene	BEI resources	NR-52394
Plasmid containing SARS CoV-2 nucleocapsid (N) gene	BEI resources	NR-53507
Software and algorithms
GraphPad Prism software version 9.1.0	https://www.graphpad.com/scientific-software/prism/	N/A
FlowJo version 10	https://www.flowjo.com	N/A
Other
KbVL8 tetramer (APC)	Provided by the NIH tetramer core at Emory University	N/A
KbN219 tetramer (PE)	Provided by the NIH tetramer core at Emory University	N/A
Forward primer, 5′ GACCCCAAAATCAGCGAAAT 3′	Integrated DNA Technologies	10006713
Reverse primer, 5′ TCTGTTTACTGCCAGTTGAATCTG 3′	Integrated DNA Technologies	10006713
Probe, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′	Integrated DNA Technologies	10006713
SARS-CoV-2 copy number control	BEI resources	NR-52358
Live dead dye for flow cytometry	Invitrogen	L34976
Cytofix/cytoperm (fixing agent for flow cytometry)	BD Biosciences	554722
Phosphate buffer saline (PBS)	GIBCO	14190-144
Golgi Plug protein transport inhibitor	BD Biosciences	555029
Golgi Stop (Monensin)	BD Biosciences	554724
DMEM	GIBCO	11965-092
Fetal bovine serum	Sigma	F0926-500