Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Name | Sequence | Description |
|---|---|---|
| USA300_stgP_F_KpnI | TTTTTTGGTACCGTTCGCTTTTGGTATTGTTT | Forward primer to amplify stgP from S. aureus |
| USA300_stgP_R_SacI | TTTTTTGAGCTCCGTTTTTTGTGTCTGGATTTA | Reverse primer to amplify stgP from S. aureus |
| USA300_hpt_F_KpnI | TTTTTTGGTACCAAAAATGGAGATGAATAGCG | Forward primer to amplify hpt from S. aureus |
| USA300_hpt_R_SacI | TTTTTTGAGCTCATTTCTCAAACGCATAGTAA | Reverse primer to amplify hpt from S. aureus |
