Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Patiria miniata) | South Coast Bio, LLC | Wild-caught animals | ||
| Antibody | Anti-CENP-C (rabbit polyclonal) | Swartz et al., 2019 | IF(1:5000) | |
| Antibody | Anti-cyclin B (rabbit polyclonal) | Ookata et al., 1992 | WB(1:1000) | |
| Antibody | Anti-alpha tubulin, DM1alpha (mouse monoclonal) | Sigma-Aldrich | Cat# T9026, RRID:AB_477593 | IF(1:5000) |
| Antibody | Anti-phoshpo-Cdk1 Y15 | Cell Signaling Technologies | Cat# 4539 | WB(1:3000) |
| Antibody | Anti-phospho ERK1/2 T202/Y204 | Cell Signaling Technologies | Cat# 9101 | WB(1:3000) |
| Antibody | Anti-pTPxK CDK consensus | Cell Signaling Technologies | Cat# 14371 | WB(1:3000) |
| Antibody | Anti-(K/H)pSP CDK consensus | Cell Signaling Technologies | Cat# 9477 | WB(1:3000) |
| Antibody | Anti-pTPP CDK consensus | Cell Signaling Technologies | Cat# 5757 | WB(1:3000) |
| Antibody | GFP booster | Chromotek | gba488-100, RRID:AB_2631386 | IF(1:500) |
| Recombinant DNA reagent | pZS281 (plasmid) |
This paper | To be deposited to Addgene | Wild-type B55-GFP (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS282 (plasmid) |
This paper | To be deposited to Addgene | DE/A mutant B55-GFP (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS283 (plasmid) |
This paper | To be deposited to Addgene | DE/K mutant B55-GFP (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS294 (plasmid) |
This paper | To be deposited to Addgene | B55-mCherry (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS295 (plasmid) |
This paper | To be deposited to Addgene | DE/A mutant B55-mCherry (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS13 (plasmid) |
This paper | To be deposited to Addgene | INCENP-GFP (pCS2+eight backbone) |
| Recombinant DNA reagent | pZS259 (plasmid) |
This paper | To be deposited to Addgene | INCENP-GFP T61S mutant (pCS2+eight backbone) |
| Recombinant DNA reagent | GST-ARPP19 | This paper | To be deposited to Addgene | For protein expression |
| Recombinant DNA reagent | pCS2+eight backbone | Gökirmak et al., 2012 | RRID:Addgene_34952 | Pol III-based shRNA backbone |
| Sequence-based reagent | Standard Control Morpholino | Gene-Tools, LLC | CCT CTT ACC TCA GTT ACA ATT TAT | |
| Sequence-based reagent | Cyclin A morpholino | Gene-Tools, LLC | Morpholino antisense oligo | TTCACTTTGTTCCCGAGATTAAC |
| Sequence-based reagent | Cyclin B morpholino | Gene-Tools, LLC | Morpholino antisense oligo | TAACCAATGCGAGTTCCGAGGAG |
| Commercial assay or kit | mMessage mMachine SP6 in vitro transcription kit | Invitrogen | Cat# AM1340 | |
| Commercial assay or kit | Poly(A) tailing kit | Invitrogen | Cat# AM1350 | |
| Commercial assay or kit | Can Get Signal Immunoreaction Enhancer Solution | Cosmo Bio USA | Cat# TYB-NKB-101T | |
| Chemical compound, drug | 1-Methyladenine | Acros Organics | AC20131-1000 | |
| Chemical compound, drug | Calyculin A | Santa Cruz Biotechnology | SC-24000A | PP1 and PP2A inhibitor |
| Chemical compound, drug | Emetine | Sigma Aldrich | E2375-500MG | Translation inhibitor |
| Chemical compound, drug | Tautomycetin | Gift from Dr. Richard Honkanen | PP1 inhibitor | |
| Software, algorithm | SPSS | SPSS | RRID:SCR_002865 | |
| Other | Hoechst 33342 stain | Life Technologies | Cat# H1399 | (2 µg/ml) |
| Other | Prolong Gold Antifade Reagent | Life Technologies | P36930 | |
| Commercial assay or kit | TMT10plex Isobaric Label Reagent Set plus TMT11-131C Label Reagent | Thermo Scientific | A34808 | |
| Commercial assay or kit | High-Select Fe-NTA Phosphopeptide Enrichment Kit | Thermo Scientific | A32992 |