Skip to main content
. 2021 Aug 3;10:e70588. doi: 10.7554/eLife.70588

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Strain, strain background (Patiria miniata) South Coast Bio, LLC Wild-caught animals
Antibody Anti-CENP-C (rabbit polyclonal) Swartz et al., 2019 IF(1:5000)
Antibody Anti-cyclin B (rabbit polyclonal) Ookata et al., 1992 WB(1:1000)
Antibody Anti-alpha tubulin, DM1alpha (mouse monoclonal) Sigma-Aldrich Cat# T9026, RRID:AB_477593 IF(1:5000)
Antibody Anti-phoshpo-Cdk1 Y15 Cell Signaling Technologies Cat# 4539 WB(1:3000)
Antibody Anti-phospho ERK1/2 T202/Y204 Cell Signaling Technologies Cat# 9101 WB(1:3000)
Antibody Anti-pTPxK CDK consensus Cell Signaling Technologies Cat# 14371 WB(1:3000)
Antibody Anti-(K/H)pSP CDK consensus Cell Signaling Technologies Cat# 9477 WB(1:3000)
Antibody Anti-pTPP CDK consensus Cell Signaling Technologies Cat# 5757 WB(1:3000)
Antibody GFP booster Chromotek gba488-100, RRID:AB_2631386 IF(1:500)
Recombinant DNA reagent pZS281
(plasmid)
This paper To be deposited to Addgene Wild-type B55-GFP (pCS2+eight backbone)
Recombinant DNA reagent pZS282
(plasmid)
This paper To be deposited to Addgene DE/A mutant B55-GFP (pCS2+eight backbone)
Recombinant DNA reagent pZS283
(plasmid)
This paper To be deposited to Addgene DE/K mutant B55-GFP (pCS2+eight backbone)
Recombinant DNA reagent pZS294
(plasmid)
This paper To be deposited to Addgene B55-mCherry (pCS2+eight backbone)
Recombinant DNA reagent pZS295
(plasmid)
This paper To be deposited to Addgene DE/A mutant B55-mCherry (pCS2+eight backbone)
Recombinant DNA reagent pZS13
(plasmid)
This paper To be deposited to Addgene INCENP-GFP (pCS2+eight backbone)
Recombinant DNA reagent pZS259
(plasmid)
This paper To be deposited to Addgene INCENP-GFP T61S mutant (pCS2+eight backbone)
Recombinant DNA reagent GST-ARPP19 This paper To be deposited to Addgene For protein expression
Recombinant DNA reagent pCS2+eight backbone Gökirmak et al., 2012 RRID:Addgene_34952 Pol III-based shRNA backbone
Sequence-based reagent Standard Control Morpholino Gene-Tools, LLC CCT CTT ACC TCA GTT ACA ATT TAT
Sequence-based reagent Cyclin A morpholino Gene-Tools, LLC Morpholino antisense oligo TTCACTTTGTTCCCGAGATTAAC
Sequence-based reagent Cyclin B morpholino Gene-Tools, LLC Morpholino antisense oligo TAACCAATGCGAGTTCCGAGGAG
Commercial assay or kit mMessage mMachine SP6 in vitro transcription kit Invitrogen Cat# AM1340
Commercial assay or kit Poly(A) tailing kit Invitrogen Cat# AM1350
Commercial assay or kit Can Get Signal Immunoreaction Enhancer Solution Cosmo Bio USA Cat# TYB-NKB-101T
Chemical compound, drug 1-Methyladenine Acros Organics AC20131-1000
Chemical compound, drug Calyculin A Santa Cruz Biotechnology SC-24000A PP1 and PP2A inhibitor
Chemical compound, drug Emetine Sigma Aldrich E2375-500MG Translation inhibitor
Chemical compound, drug Tautomycetin Gift from Dr. Richard Honkanen PP1 inhibitor
Software, algorithm SPSS SPSS RRID:SCR_002865
Other Hoechst 33342 stain Life Technologies Cat# H1399 (2 µg/ml)
Other Prolong Gold Antifade Reagent Life Technologies P36930
Commercial assay or kit TMT10plex Isobaric Label Reagent Set plus TMT11-131C Label Reagent Thermo Scientific A34808
Commercial assay or kit High-Select Fe-NTA Phosphopeptide Enrichment Kit Thermo Scientific A32992