Skip to main content
. 2021 Aug 6;10:e65952. doi: 10.7554/eLife.65952

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (Mus musculus) Naa10 GenBank MGI:MGI:1915255
Gene (M. musculus) Naa15 GenBank MGI:MGI:1922088
Gene (M. musculus) Naa11 GenBank MGI:MGI:2141314
Gene (M. musculus) Naa12 This paper Gm16286, UniProt: Q9CQX6 Provided by corresponding author, Gholson J. Lyon
Genetic reagent (M. musculus) Naa10-/- Nature Communication Yoon et al., 2014 Provided by corresponding author, Goo Taeg Oh
Genetic reagent (M. musculus) Naa12-/- This paper Gm16286, UniProt: Q9CQX6 Provided by corresponding author, Gholson J. Lyon
Cell line (Homo sapiens) HEK293 (normal, embryonic kidney cells) ATCC CRL-1573
Biological sample (M. musculus) Primary mouse embryonic fibroblasts This paper Freshly isolated from mouse embryos (E13.5)
Antibody Anti-Naa10 (rabbit polyclonal) Abcam Cat# ab155687 (1:1000)
Antibody Anti-Naa10 (rabbit polyclonal) Protein Tech Cat# 14803-1-AP (1:3000)
Antibody Anti-Naa10 (rabbit monoclonal) Cell Signaling Cat# 13357 (1:1000)
Antibody Anti-Naa10 (goat polyclonal) Santa Cruz Cat# sc-33256 (1:1000)
Antibody Anti-Naa10 (rabbit polyclonal) Santa Cruz Cat# sc-33820 (1:1000)
Antibody Anti-Naa11 (rabbit polyclonal) Novus Biologicals Cat# NBP1-90853 (1:1000)
Antibody Anti-Naa15/NARG1 (mouse monoclonal) Abcam Cat# ab60065 (1:1000)
Antibody Anti-NAA15 (rabbit polyclonal) Biochemical Journal (reference 12 in this paper)
Arnesen et al., 2005
(1:2000)
Provided by author Thomas Arnesen,
Antibody Anti-NAA50 (rabbit polyclonal) LifeSpan BioSciences Cat# LS-C81324-100 (1:3000)
Antibody Anti-FLAG (rabbit polyclonal) Sigma-Aldrich Cat# F7425 (2 μg/mL)
Antibody Anti-GAPDH (mouse monoclonal) Abcam Cat# ab9484 (1:3000)
Antibody Anti-actin (goat polyclonal) Santa Cruz Cat# 1615 (1:3000)
Antibody Anti-GST (mouse monoclonal) GenScript Cat# A00865 (1 µg/mL)
Antibody Anti-V5 (mouse monoclonal) Life Technologies Cat# R960-25 (1:1000)
Antibody Anti-Naa12 (rabbit polyclonal) This paper Gm16286, UniProt: Q9CQX6 C-terminus (aa191-205: QENLAGGDSGSDGKD-C) conjugated to OVA by PrimmBiotech
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa10-Exon2/3_F This paper PCR primers ctcttggccccagctttctt
Provided by corresponding author, Goo Taeg Oh
Sequence-based reagent mNaa10-Exon3/4_R This paper PCR primers tcgtctgggtcctcttccat
Provided by corresponding author, Goo Taeg Oh
Sequence-based reagent mNaa11_F This paper PCR primers accccacaagcaaagacagtg
Provided by corresponding author, Goo Taeg Oh
Sequence-based reagent mNaa11_R This paper PCR primers agcgatgctcaggaaatgctct
Provided by corresponding author, Goo Taeg Oh
Sequence-based reagent mNaa12(Gm16286)_F This paper PCR primers acgcgtatgctatgaagcga
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa12(Gm16286)__R This paper PCR primers ccaggaagtgtgctaccctg
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa15_F This paper PCR primers gcagagcatggagaaaccct
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa15_R This paper PCR primers tctcaaacctctgcgaacca
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa50_F This paper PCR primers taggatgccttgcaccttacc
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mNaa50_R This paper PCR primers gtcaatcgctgactcattgct
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mGAPDH_F This paper PCR primers aggtcggtgtgaacggatttg
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mGAPDH_R This paper PCR primers tgtagaccatgtagttgaggtca
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mACTB_F This paper PCR primers ggctgtattcccctccatcg
Provided by corresponding author, Gholson J. Lyon
Sequence-based reagent mACTB_R This paper PCR primers ccagttggtaacaatgccatgt
Provided by corresponding author, Gholson J. Lyon
Software, algorithm Zen 3.0 SR ZEISS Version 16.0.1.306 Black 64bit edition
Other Alcian Blue 8GX Sigma-Aldrich Cat# A5268 0.03%
Other Alizarin Red Sigma-Aldrich Cat# A5533 0.05%
Other Hematoxylin Sigma-Aldrich Cat# MHS80
Other Eosin Sigma-Aldrich Cat# HT110116