. 2021 Aug 6;11:628531. doi: 10.3389/fonc.2021.628531

Table 2.

Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.

Medical record No	Genetic changes associated with HB paroxysm	Abundance / Amplification multiple	Unknown genetic change	Abundance / Amplification multiple	MSI	TMB	PDL1	Pathological type	β-catenin	Recurrence or metastasis	Survival time	Prognosis
1	NFE2L2 c.230A>G p.D77G	48.30%	KMT2D c.5467G>T p.G1823X	11.70%	MSS	3.9	<1%	Epithelium and lobus intermedius mixed type	Positive	Metastasis	9	PR
			NUP210L c.4475G>A p.G1492E	20.00%
			ARID1A c. 2714C>G p.A905G	18.50%
			TRIM23 c.868G>T p.A290S	16.80%
			PTPRB c.5432A>G p.K1811R	11.90%
			AURKA amplification	1.51
2					MSS	0	<1%	Epithelium and lobus intermedius mixed type	Positive	Recurrence	17	CR
3			ARID1A	37.20%	MSS	1.69	1.00%	Fetal and embryonic mixed type	Positive	Recurrence	29	CR
3			c.4764-4770delT p.A1589fs	37.20%	MSS	1.69	1.00%	Fetal and embryonic mixed type	Positive	Recurrence	29	CR
4	NFE2L2 c.92G>C p.G31A	22.00%	EP300 c.3244_3245delinsTT p.Q1082L	48.70%	MSS	1.69	<1%	Fetal type	Positive	Recurrence	21	CR
4	NFE2L2 c.92G>C p.G31A	22.00%	PARP1 c.2680G>T p.G894N	29.00%	MSS	1.69	<1%	Fetal type	Positive	Recurrence	21	CR
5	CTNNB1 c.101G>T p.G34V	11.60%			MSS	3.18		Epithelium and lobus intermedius mixed type	Positive	Recurrence	23	PR
6					MSS	0		Fetal and embryonic mixed type	Positive	No	12	CR
7	MYCN amplification	1.5	TCF7L2 c.1258C>T p.R420W	26.00%	MSS	2.25	1-2%	Epithelium and lobus intermedius mixed type	Focal positive	Recurrence	22	Dead
7	MYCN amplification	1.5	MED12 c.5382G>T p.Q1794H	24.70%	MSS	2.25	1-2%	Epithelium and lobus intermedius mixed type	Focal positive	Recurrence	22	Dead
8			USP9X c.1916C>T p.P639L	37.90%	MSS	3.93	2.00%	Embryo and giant trabecular mixed type	Positive	Recurrence	15	PR
8			NOTCH3 c.3991C>G p.P1331A	10.20%	MSS	3.93	2.00%	Embryo and giant trabecular mixed type	Positive	Recurrence	15	PR
9	CTNNB1 c.1003A>C p.K335Q	45.50%			MSS	1.69		Fetal and embryonic mixed type	Positive	Recurrence	30	Dead
10			BCL6 c.959A>G p.N320S	12.70%	MSS	2.25		Fetal type	Positive	Metastasis	21	CR
10			HIST1H3F c.148C>G p.R50G	11.90%	MSS	2.25		Fetal type	Positive	Metastasis	21	CR
11	CTNNB1 c.94G>A p.D32N	23.00%	INPP4A c.959A>G p.N320S	14.80%	MSS			Fetal and embryonic mixed type	Positive	Recurrence or metastasis	17	PD
11	TP53 c.743G>A p.R248Q	47.30%	RFWD2 c.173C>G p.S58W	13.90%	MSS			Fetal and embryonic mixed type	Positive	Recurrence or metastasis	17	PD
12	CTNNB1 c.121A>G p.T41A	27.50%			MSS			Fetal and embryonic mixed type	Positive	No	20	CR
13	AXIN1	13.11%	EPHA7 c.1909C>T p.R637C	7.16%	MSS	22		giant beam type	Positive	Recurrence after PD	50	Dead
13	c.516_537del CATGAAGCAGCTGATCGATCCT p.I172Mfs*63	13.11%	NRAS c.182A>G p.Q61R	6.26%	MSS	22		giant beam type	Positive	Recurrence after PD	50	Dead
14	APC c.5465T>A p.V1822D	11.20%	PIK3C2B c.533C>T p.P178L	36.50%	MSS	5	0	Fetal type	Positive	Recurrence or metastasis	40	PR
			IGF2	31.61%
			c.517_538dup ACACCTGGAAGCAGTCCACC p.Q180Rfs*78
			NORCH1 c.1820G>T p.C607F
			DICER1	28.96%
			c.4082A>G p.K1361R
			c.4064A>G p.N1355S	25.40%
				25.06%
15	CTNNB1 c.53_241+117del306	47.50%			MSS	0		Epithelium and lobus intermedius mixed type	negative	PD	25	Dead
16	CTNNB1	21.20%	NUP93 c.180-2A>T	41.40%	MSS	1.34	1-2%	Epithelium and lobus intermedius mixed type	Positive	Recurrence or metastasis	24	CR
	c.66_95del p.His24_Ser33del		PREX2 c.2741C>G p.A914G	38.30%
			PAK7 c.1573T>C p.F525L	28.60%
17			ATRX c.2701C>G p.I901V	8.14%	MSS	9		Epithelium and lobus intermedius mixed type	Positive	Recurrence	9	CR
			PTCH1 c.2479A>G p.S827G	5.60%
			MPL c.173C>T p.A58VG	6.40%
18	CTNNB1 c.94G>A p.D32N	14.14%			MSS	4.8		Fetal and embryonic mixed type	Positive	Recurrence	15	CR
19					MSS	1.11		Fetal and embryonic mixed type	Positive	Recurrence	23	CR

Only genetic changes with mutation abundance ≥5% are listed; MSI, microsatellite instability; MSS, microsatellite stability; TMB, tumor mutation burden; CR, complete remission; PR, partial response; PD, disease progression.