REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
REGN10933	Hansen et al., 2020	N/A
C002	Robbiani et al., 2020	N/A
REGN10987	Hansen et al., 2020	N/A
CR3022	ter Meulen et al., 2006	Accession#DQ168569.1, DQ168570.1
S309	Pinto et al., 2020	N/A
51F12 (anti-nuclear antibody)	Sakakibara et al., 2017	N/A
72H11 (anti-nuclear antibody)	Sakakibara et al., 2017	N/A
Human IgG1	Southern Biotech	Cat#0151K-01
HPR-conjugated goat anti-human IgG	Southern Biotech	Cat#2040-05
Hyper-immune rabbit serum raised against the GST-tagged N protein of SARS-CoV-2	In-house	N/A
Histofine® Simple Stain MAX PO (R)	Nichirei Biosciences	Cat#424141
Alexa Fluor 594 goat anti-Human IgG	Thermo Fisher Scientific	Cat#A-11014
Anti-mouse FcγRII/III	In-house	2.4G2
Anti-mouse CD43, biotinylated	BD Biosciences	Cat#553269
Anti-mouse CD90, biotinylated	Thermo Fisher Scientific	Cat#13-0903-85
Anti-mouse CD3, biotinylated	BioLegend	Cat#100304
Anti-mouse c-kit, biotinylated	BioLegend	Cat#105803
Anti-mouse F4/80, biotinylated	BioLegend	Cat#123106
Anti-mouse Gr-1, biotinylated	Thermo Fisher Scientific	Cat#13-5931-85
Anti-mouse CD4, biotinylated	BioLegend	Cat#100404
Anti-mouse CD8, biotinylated	BioLegend	Cat#100704
Anti-mouse CD11b, biotinylated	BioLegend	Cat#101204
Anti-mouse Ter119, biotinylated	BioLegend	Cat#116204
Anti-mouse CD93, biotinylated	Thermo Fisher Scientific	Cat#13-5892-85
Anti-mouse CD11c, biotinylated	BioLegend	Cat#117304
Anti-mouse CD138, biotinylated	BD Biosciences	Cat#553713
Anti-human IgD, biotinylated	BD Biosciences	Cat#555777
Anti-mouse B220, BV786 conjugated	BioLegend	Cat#103246
Anti-mouse CD38, AF700 conjugated	Thermo Fisher Scientific	Cat#56-0381-82
Rabbit anti-SARS-CoV-2 N antibody	Nagata et al., 2021	N/A
Bacterial and virus strains
h-CoV-19/Japan/TY-WK-521/2020	National Institute of Infectious Diseases	EPI_ISL_408667
hCoV-19/Japan/QK002/2020	National Institute of Infectious Diseases	EPI_ISL_768526
hCoV-19/Japan/QHN001/2020	National Institute of Infectious Diseases	EPI_ISL_804007
hCoV-19/Japan/QHN002/2020	National Institute of Infectious Diseases	EPI_ISL_804008
hCoV-19/Japan/TY7-501/2021	National Institute of Infectious Diseases	EPI_ISL_833366
hCoV-19/Japan/TY7-503/2021	National Institute of Infectious Diseases	EPI_ISL_877769
QH-329-037-p3d1	National Institute of Infectious Diseases	DRA012137
SARS coronavirus Frankfurt 1	Thiel et al., 2003	AY291315
VSV pseudovirus bearing SARS-CoV-2 spike protein	Tani et al., 2021	N/A
VSV pseudovirus bearing WIV-1 spike protein	In-house	N/A
Escherichia coli strain DH5alpha	Clontech	Cat#9057
Chemicals, peptides, and recombinant proteins
SARS-CoV-2 RBD (amino acids: 331–529)	In-house	MN994467
G504V RBD	In-house	N/A
SARS-CoV-2 spike protein (amino acids: 1-1213)	In-house	MN994467
SARS-CoV-1 RBD (amino acids: 310-509)	In-house	EU371563
SARS-CoV-1 spike protein (amino acids: 15-1195)	In-house	EU371563
MERS-CoV RBD (amino acids: 367-606)	In-house	KF192507
MERS-CoV spike protein (amino acids: 13-1296)	In-house	KF192507
HCoV-NL63 spike protein (amino acids: 22-1293)	In-house	NC_005831
HCoV-OC43 spike protein (amino acids: 12-1299)	In-house	NC_006213
HCoV-229E spike protein (amino acids: 12-1109)	In-house	NC_002645
HCoV-HKU1 spike protein (amino acids: 13-1293)	In-house	NC_006577
Recombinant Human ACE2	BioLegend	Cat#792006
HiTrap Protein G HP Columns	Cytiva	Cat#17-0404-01
StrepTactin Sepharose	iba	Cat#2-5030-010
cOmplete His-Tag Purification Resin	Roche	Cat#0589682001
Superose TM 6 Increase 10/300 GL	Cytiva	Cat#29-0915-96
Superdex TM 200 Increase 10/300 GL	Cytiva	Cat#28-9909-44
Superdex TM 200 10/300 GL	Cytiva	Cat#17517501
Gel Filtration Standard	BioRad	Cat#1511901
TALON® Metal Affinity Resin	Clontech	Cat#635504
HisTALON Buffer Set	Clontech	Cat#635651
Ni-NTA agarose	QIAGEN	Cat#30230
Recombinant mouse IL-2	Peprotech	Cat#212-12
Recombinant mouse IL-4	Peprotech	Cat#214-14
Recombinant mouse IL-5	Peprotech	Cat#215-15
Fetal bovine serum	Biowest	Cat#S1780-500
Fetal bovine serum	Hyclone	Cat#SH30396.03
Normal goat serum	Jackson Immuno Research Laboratories	Cat#005-000-121
DNA (Calf Thymus)	Worthington Biochemical Corporation	Cat#LS002105
Insulin from bovine pancreas	Sigma-Aldrich	Cat#I5500
Lipopolysaccharides from Escherichia coli O111:B4	Sigma-Aldrich	Cat#L3024
AddaVax	InvivoGen	Cat#vac-adx-10
Freund’s Adjuvant, Incomplete	Sigma	Cat#F5506-10ML
iSeq 100 Reagent	Illumina	Cat#20021533
Low glucose DMEM	Fujifilm Wako Pure Chemicals	Cat#041-29775
DMEM (High Glucose)	Fujifilm Wako Pure Chemicals	Cat#044-29765
RPMI	Fujifilm Wako Pure Chemicals	Cat#189-02025
Opti-MEM I medium	Thermo Fisher Scientific	Cat#31985070
NEAA	Thermo Fisher Scientific	Cat#11140-050
HEPES	Thermo Fisher Scientific	Cat#15630-080
HEPES	DOJINDO	Cat#340-01376
Sodium Pyruvate	Thermo Fisher Scientific	Cat#11360-070
2-mercapt ethanol	Thermo Fisher Scientific	Cat#21985-023
Geneticin	Thermo Fisher Scientific	Cat#10131-027
Penicillin/streptomycin	Thermo Fisher Scientific	Cat#15140-122
Poly-L-Lysine	Fujifilm Wako Pure Chemicals	Cat#333-30751
Bovine serum albumin	Sigma-Aldrich	Cat#A2153
Tween-20	Fujifilm Wako Pure Chemicals	Cat#167-11515
Triton X-100	Nacalai Tesque	Cat#12969-25
Can Get Signal #2	TOYOBO	Cat#NKB-301
OPD substrate	Sigma-Aldrich	Cat#P8287
Formalin	Fujifilm Wako Pure Chemicals	Cat#062-01661
Crystal violet solution	Sigma-Aldrich	Cat#V5265
Polyethylene glycol 8,000	Hampton Research	Cat#HR2-535
Ethylene Glycol	Fujifilm Wako Pure Chemicals	Cat#058-00986
3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide	Nacalai Tesque	Cat#23547-34
Tissue-Tek® Paraffin WaxII60	Sakura Finetek Japan	Cat#7810
Retrieval Solution pH6	Nichirei Biosciences	Cat#415281
3,3′-diaminobenzidine	Sigma-Aldrich	Cat#D5637
Hematoxylin cryst. (C.I. 75290)	Merck	Cat#1.04302.0025
Multimount 480	Matsunami Glass	Cat#FM48005
Fluoro-KEEPER Antifade reagent with DAPI	Nacalai Tesque	Cat#12745-74
TRIzol	Thermo Fisher Scientific	Cat#15596
Streptavidin MicroBeads	Miltenyi Biotec	Cat#130-048-101
Streptavidin-eFluor450	Thermo Fisher Scientific	Cat#48-4317-82
Streptavidin-HRP	Southern Biotech	Cat#7100-05
Streptavidin-HRP	Thermo Fisher Scientific	Cat#434323
DAPI	Thermo Fisher Scientific	Cat#D1306
HBS-EP Buffer	Cytiva	Cat#BR100188
HBS-EP+ 10X	Cytiva	Cat#BR100669
Glycine 1.5	Cytiva	Cat#BR100354
NaOH 50	Cytiva	Cat#BR100358
Human-b2-microglobulin	In-house	NP_004039.1
Biotinylated-human-b2-microglobulin	In-house	N/A
Critical commercial assays
RNeasy mini kit	QIAGEN	Cat#74104
Direct-zol RNA Miniprep	Zymo research	Cat#R2052
Gibson Assembly Master Mix	New England Biolabs	Cat#E2611
SuperScript VILO Master Mix	Thermo Fisher Scientific	Cat#11755250
Wizard SV Gel and PCR Clean-Up System	Promega	Cat#A9282
Wizard Plus SV Minipreps DNA Purification Systems	Promega	Cat#A1460
PureYield Plasmid Midiprep System	Promega	Cat#A2495
R-Phycoerythrin Labeling Kit - NH2	DOJINDO	Cat#LK23
Allophycocyanin Labeling Kit - NH2	DOJINDO	Cat#LK21
QIAseq FX DNA Library kit	QIAGEN	Cat#180473
Bright-Glo luciferase assay system	Promega	Cat#E2620
Expi293 expression system	Thermo Fisher Scientific	Cat#A29133
Cell counting kit 8	Fujifilm Wako Pure Chemicals	Cat#343-07623
QuantiTect Probe RT-PCR Kit	QIAGEN	Cat#204443
Kallestad HEp-2 IFA kit	Bio-Rad	Cat#30471
Biotin Capture Kit	Cytiva	Cat#28920233
Amine Coupling Kit	Cytiva	Cat#BR100050
Deposited data
Crystal structure of RBD-NT193 complex	This paper	PDB: 7E5O
NT-108	This paper	Accession#MW619740, MW619741
NT-193	This paper	Accession#MW619742, MW619743
BWA-mem version 0.7.13-r1126	Li and Durbin, 2009	https://github.com/lh3/bwa
VarScan version 2.4.3	Koboldt et al., 2012	http://varscan.sourceforge.net/using-varscan.html
Experimental models: Cell lines
VeroE6/TMPRSS2 cells	JCRB Cell Bank	JCRB1819
VeroE6 cells	ATCC	CRL-1586
NB21.2D9	Kuraoka et al., 2016	N/A
Experimental models: Organisms/strains
TC-mAb mouse	Satofuka et al., 2020.	N/A
Syrian hamster	Japan SLC	N/A
Oligonucleotides
CpG ODN1760	Eurofins genomics	N/A
5′- AAATTTTGGGGACCAGGAAC −3′	Eurofins genomics	NIID_2019-nCOV_N_F2
5′- TGGCAGCTGTGTAGGTCAAC −3′	Eurofins genomics	NIID_2019-nCOV_N_R2
5′- FAM- ATGTCGCGCATTGGCATGGA-BHQ −3′	Eurofins genomics	NIID_2019-nCOV_N_P2
ARTIC-N2 primer	Itokawa et al., 2020	https://www.protocols.io/researchers/kentaro-itokawa
Recombinant DNA
Plasmid: pCMV-CoV2S-foldon-avi	This paper	N/A
Plasmid: pCAGGS-COV2RBD-avi	This paper	N/A
Plasmid: pCAGGS-COV2RBD_G504V	This paper	N/A
Plasmid: pMT-COV1_S	This paper	N/A
Plasmid: pMT-HCoV-NL63_S	This paper	N/A
Plasmid: pMT-HCoV-OC43_S	This paper	N/A
Plasmid: pMT-HCoV-229E_S	This paper	N/A
Plasmid: pMT-HCoV-HKU1_S	This paper	N/A
Plasmid: pHLsec-CoV2RBD	This paper	N/A
Plasmid: pHLsec-CoV1RBD	This paper	N/A
Plasmid: pHLsec-MERSRBD	This paper	N/A
Plasmid: phIgG1-NT193	This paper	N/A
Plasmid: phIgG3-NT193	This paper	N/A
Plasmid: phIgk-NT193	This paper	N/A
Plasmid: phIgG1-NT108	This paper	N/A
Plasmid: phIgk-NT108	This paper	N/A
Plasmid: phIgG1-REGN10933	This paper	N/A
Plasmid: phIgk-REGN10933	This paper	N/A
Plasmid: phIgG1-REGN10987	This paper	N/A
Plasmid: phIglambda-REGN10987	This paper	N/A
Plasmid: phIgG1-S309	This paper	N/A
Plasmid: phIgk-S309	This paper	N/A
Plasmid: phIgG1-C002	This paper	N/A
Plasmid: phIgk-C002	This paper	N/A
Plasmid: pVRC-NT193Fab	This paper	N/A
Software and algorithms
Graphpad Prism 9	Graphpad	https://www.graphpad.com/scientific-software/prism/
StepOne Software v2.3	Applied Biosystems	https://www.thermofisher.com/jp/ja/home/technical-resources/software-downloads/StepOne-and-StepOnePlus-Real-Time-PCR-System.html
FLOWJO X 10.7.2	BD	https://www.bdbiosciences.com/en-in/products/software/flowjo-v10-software
Octet Data Analysis Software 11.1.0.4	Sartorius	https://www.sartorius.com/en/products/protein-analysis/octet-systems-software
BIAevaluation version 4.1.1	Cytiva	https://www.cytivalifesciences.com/en/gb/shop/protein-analysis/spr-label-free-analysis
T200 Evaluation version 1.0	Cytiva	https://www.cytivalifesciences.com/en/gb/shop/protein-analysis/spr-label-free-analysis
FV10-ASW 4.2 Viewer	Olympus	N/A
Origin 2017	OriginLab	https://www.originlab.com/
UNICORN 6.3	Cytiva	https://www.cytivalifesciences.com/en/gb/shop/chromatography
Imaging Software cellSens ver. 1.16	Olympus	N/A
BWA-mem version 0.7.13-r1126	Li and Durbin, 2009	https://github.com/lh3/bwa
VarScan version 2.4.3	Koboldt et al., 2012	http://varscan.sourceforge.net/using-varscan.html
XDS	Kabsch, 2010	https://xds.mr.mpg.de/
CCP4 7.1	Winn et al., 2011	http://www.ccp4.ac.uk
PHENIX version 1.18	Liebschner et al., 2019	https://www.phenix-online.org/
The PyMol Molecular Graphics System	Schrödinger, LLC	https://pymol.org/
PDBePISA	Krissinel and Henrick, 2007	https://www.ebi.ac.uk/pdbe/pisa/
Coot version 0.9.1	Emsley et al., 2010	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot
MolProbity	Davis et al., 2007	https://www.phenix-online.org/
Other
StepOnePlus Real-Time PCR System	Applied Biosystems	https://www.thermofisher.com/order/catalog/product/4376598#/4376598
iSeq 100 Sequencing System	Illumina	https://www.illumina.com/systems/sequencing-platforms/iseq/order-iseq-100.html
FACSAria III Cell Sorter	BD Biosciences	https://www.bdbiosciences.com/ja-jp/products/instruments/flow-cytometers/research-cell-sorters/bd-facsaria-iii
iMark microplate reader	Bio-Rad	https://www.bio-rad.com/ja-jp/product/imark-microplate-absorbance-reader?ID=58cca7aa-d943-4e32-9bea-0fe5d140fb9e
Epoch2	Biotek	https://www.biotek.com/products/detection-microplate-readers/epoch-2-microplate-spectrophotometer/
GloMax Navigator Microplate Luminometer	Promega	https://www.promega.com/products/microplate-readers-fluorometers-luminometers/microplate-luminometers/glomax-navigator-system/?catNum=GM2000&cs=y
FV1000 confocal laser scanning microscope	Olympus	https://www.olympus-lifescience.com/en/technology/museum/micro/2004/
System Microscope BX53	Olympus	https://www.olympus-lifescience.com/en/microscopes/upright/bx53f2/
Digital microscope camera DP71	Olympus	https://www.olympus-lifescience.com/en/technology/museum/micro/2006/
TissueLyser LT instrument	QIAGEN	https://www.qiagen.com/jp/shop/pcr/tissuelyser-lt/
ÄKTA pure protein purification system	Cytiva	https://www.cytivalifesciences.com/en/us/shop/chromatography/chromatography-systems/akta-pure-p-05844
Biacore 3000	Cytiva	https://www.cytivalifesciences.com/en/us/shop/biacore-3000-goldseal-p-02795
Biacore T200	Cytiva	https://www.cytivalifesciences.com/en/us/shop/protein-analysis/spr-label-free-analysis/systems/biacore-t200-p-05644
Biolayer Interferometry	Sartorius	OctetRED96e system
LS Columns	Miltenyi Biotec	Cat#130-042-401
Sensor chip CM5 Series S	Cytiva	Cat#29149603
Streptavidin Biosensors	Sartorius	Cat#5020
Microscope slide	Matsunami Glass	Cat#FRC-11