TABLE 3.
Analysis of leader substitution constructsa
| Sequence of mutant leaderb | SL RNA expressionc | No. of rescued lines/ total no. of lines | % Rescue of wDf1 embryonic lethality (n) | Embryonic rescue |
|---|---|---|---|---|
| No construct injected | NA | NA | 0 (2,039) | NA |
| GGUUUAAUUACCCAAGUUUGAG (wild type) | NDd | 6/7e | 54 (2,525) | + |
| GGUUUAAUUACCCAAGUUUAAG (G20 → A20) | 68 | 9/11e | 56 (2,814) | + |
| GGUUUAAUUACCAGGCGAAUAG (loop sub) | 30 | 7/14e | 33 (7,292) | + |
| GGUUUAAUUAAGAUCUCUCGAG (11–20 shuffle) | 100 | 0/12 | 0 (2,606) | − |
| GGUUUUAACCCAGUUACUCAAG (SL2-SL1 intron) | 24 | 0/10f | 0 (1,857) | − |
NA, not applicable. Percent rescue was calculated and embryonic rescue was scored as described in notes b and c to Table 1 and Materials and Methods.
Nucleotides that are different from those in the wild-type SL1 leader are underlined. SL RNA expression and secondary structures were determined as described in Table 2 and Materials and Methods.
Expression level is shown as a percentage of the level seen for the highest-expressing mutant (11–20 shuffle) (Fig. 4B) after normalizing for loading.
ND, not determined.
Lines that showed no apparent rescue were not used in the calculation of percent rescue.
For two lines, the percent embryonic lethality was 19 and 19.4%, respectively. Normally, percentages below 20% are indicative of rescue. However, these lines appear to be atypical of constructs which normally result in rescue. Progeny from only one animal were counted from these lines, and the eight remaining lines exhibited no evidence of rescue, indicating that these percentages are not likely to be significant.