TABLE 1.
Genetic composition of the antibiotic resistance island containing the class 1 integron In2020
| IS/integron elementa | Gene identifier | Gene name | Direct/inverted repeat(s)b | Gene functionc |
|---|---|---|---|---|
| Hypothetical proteind | ||||
| 5′-PA0981d | DR: AATAAgggct | |||
| IAU57_09040 | Hypothetical protein | |||
| IAU57_09045 | Hypothetical protein | |||
| IAU57_09050 | Hypothetical protein | |||
| IAU57_09055 | Conserved protein | DNA recombination protein RmuC | ||
| ISPa85 | IAU57_09060 | istA | IRL: tgcggattccacgctgactcggacacccattccacgcacatccgg | IS21 family transposase |
| IAU57_09065 | istB | IRR: tgcggattccacgccattcggacactcagcccacgctgatccgga | IS21-like element ISUnCu3 family helper ATPase | |
| IAU57_09070 | tonB | TonB C-terminal domain-containing protein | ||
| IAU57_09075 | Integrase | Tyrosine-type, site-specific recombinase/integrase | ||
| IS6100 | IAU57_09080 | tnpA2 | IRL: ggctctgttgcaaagattggcggcagtcagagg; IRR: ggctctgttgcaaaaatcgtgaagcttgagcat | IS6-like element |
| In2020 | IAU57_09085 | N-Acetyltransferase | GNAT family protein | |
| IAU57_09090 | sul1 | Sulfonamide-resistant dihydropteroate synthase | ||
| IAU57_09095 | qacEΔ1 | Quaternary ammonium compound efflux SMR (truncated) transporter | ||
| IAU57_09100 | bla OXA-2 | Oxacillin-hydrolyzing class D β-lactamase | ||
| IAU57_09105 | aacA27 | Aminoglycoside N-acetyltransferase AAC(6′)-IIc | ||
| IAU57_09110 | intI1 e | Class 1 integron integrase IntI1 | ||
| ISPsy42 | IAU57_09115 | yafQ | IRR: aatgatgacctcaagccggttctggtcg | Type II toxin-antitoxin system |
| IAU57_09120 | Invertase | Recombinase family protein; DNA invertase Pin-like protein | ||
| IAU57_09125 | tnpR | IRL: aatgttctccgtggcccgcttccggccg | TnpR resolvase protein | |
| 3′-PA0981d | DR: accccAATAA | |||
| IAU57_09130 | Hypothetical protein |
a
A novel integron was identified in this study.
b
DR, direct repeat; IRL, left inverted repeat; IRR, right inverted repeat. Lowercase letters are used for gene sequences and capital letters are used for direct repeat sequences.
c
Putative functions of the gene were identified from an NCBI protein BLAST search. GNAT, GCN5-related N-acetyltransferase; SMR, small multidrug resistance.
d
Gene was not annotated in CMC-097.
e
Gene was truncated and overlapped.