TABLE 1.
Sequences of primers and oligonucleotides used in the reverse line blotting assay
| Oligonucleotide | Sequence | Specificity | Position in 16S rRNA (source)a | Reference or source |
|---|---|---|---|---|
| 16SIF | AGAGTTTGATCMTGGYTCAG | Eubacteria | 8–27 (E. coli) | 1 |
| 16SIR | CTTTACGCCCARTRAWTCCG | Eubacteria | 556–575 (E. coli) | 1 |
| ARC1 | CAACAAAGTTGGAGCATCATCG | A. turicensis | 59–38 (X78720) | This study |
| ARC2 | AGAAACCACAAAGGCCCCT | A. radingae | 211–193 (X78719) | This study |
| ARC3 | CCGCAAGCAGGAGCCTT | A. haemolyticum | 59–43 (X73952) | This study |
| ARC4 | CCACCAAAAACACCAAAAGTGTAT | Actinomyces species | 213–190 (strain 8813) | This study |
| ARC5 | CAGGCTTATCCCAAAGACAAG | A. bernardii and A. pyogenes | 127–108 (X79224) | This study |
| ARC6 | CCCCATGCGAAGACCAG | A. odontolyticus | 97–81 (X8721) | This study |
| ARC7 | CATGCGACCAGCCTGGA | A. europaeus | 190–174 (Y08828) | This study |
a
Designations beginning with X or Y are GenBank accession numbers.