Skip to main content
. 2021 Sep 1;2(3):100748. doi: 10.1016/j.xpro.2021.100748
REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins

Hydrofluoric acid (HF) Sigma-Aldrich 339261
Halocarbon oil- 700 CAS#9002-83-9 Sigma-Aldrich H8898
Agarose Genesee Scientific 20-102GP
tracrRNA IDT Cat# 1072532
TE 7.5 (10 mM Tris, 0.1 mM EDTA) IDT Cat#11-01-02-02
Nuclease-Free Duplex Buffer (30 mM HEPES, pH 7.5; 100 mM potassium acetate) IDT Cat#11-01-03-01
Polyethylene Glycol 8000 (PEG) MP #195445
Q5 polymerase NEB Cat# M0491S
S. pyogenes Cas9 3NLS protein IDT Cat#1081058
Cas12a protein IDT Cat#10001272

Critical commercial assays

Gel Extraction Kit QIAGEN-Qiaquick #28706

Experimental models: Organisms/Strains

C. elegans N2 strain Caenorhabditis Genetics Center N/A

Oligonucleotides

CRISPR-Cas9 crRNA, 2 nmol IDT N/A
A.s. Cas12a crRNA, 2 nmol IDT N/A
ssODN donors (ultramer) IDT N/A
GFP forward primer This study AGTAAAGGAGAAGAACTT
GFP reverse primer This study TTTGTATAGTTCATCCATGC
Universal linker forward This study TCCGGAGGGAGTGGA
Universal linker reverse This study AGAACCTCCGCCACC

Recombinant DNA

GFP-linker plasmid Addgene N/A
FLAG-TEV-degron-linker plasmid Addgene N/A
mCherry linker plasmid Addgene N/A
PRF4::rol-6 (su1006); now named pCCM958 Addgene N/A

Other

Glass capillaries World Precision Instruments #1B120F-4
Cover slips 24 x 60 mm No.1 Globe Scientific Inc #1419-10
Cover slips 22 x 22 mm No.1 Globe Scientific Inc #1404-10
Mouth pipette -15 In Drummond aspirator tube assembly Thermo Fisher Scientific #2118010
PCR purification columns QIAGEN-Minelute #28604
Ampure XP beads Beckman Coulter Ref# A63880
Tygon tubing E-3603 (ID:1/32 in; OD:3/32 in; Wall: 1/32 in) Saint-Gobain #00444
Microloader Tips (Femtotips) Eppendorf 930001007
Dissecting scope Nikon SMZ745
Inverted microscope (DIAPHOT 200) Nikon Current successor: Eclipse Ti2
Fluorescence dissecting microscope Zeiss Axio Zoom. V16
Needle Puller Narishige PN-30 Narishige Current successor: PC-100
Microinjector Tritech Research, Inc Analog MINJ-1
Micromanipulator Narishige MN-151
Thermal Cycler Bio-Rad 1851148