Actin-related protein 2/3 complex plays a critical role in the aquaporin-2 exocytotic pathway

Abstract

The trafficking of proteins such as aquaporin-2 (AQP2) in the exocytotic pathway requires an active actin cytoskeleton network, but the mechanism is incompletely understood. Here, we show that the actin-related protein (Arp)2/3 complex, a key factor in actin filament branching and polymerization, is involved in the shuttling of AQP2 between the trans-Golgi network (TGN) and the plasma membrane. Arp2/3 inhibition (using CK-666) or siRNA knockdown blocks vasopressin-induced AQP2 membrane accumulation and induces the formation of distinct AQP2 perinuclear patches positive for markers of TGN-derived clathrin-coated vesicles. After a 20°C cold block, AQP2 formed perinuclear patches due to continuous endocytosis coupled with inhibition of exit from TGN-associated vesicles. Upon rewarming, AQP2 normally leaves the TGN and redistributes into the cytoplasm, entering the exocytotic pathway. Inhibition of Arp2/3 blocked this process and trapped AQP2 in clathrin-positive vesicles. Taken together, these results suggest that Arp2/3 is essential for AQP2 trafficking, specifically for its delivery into the post-TGN exocytotic pathway to the plasma membrane.

NEW & NOTEWORTHY Aquaporin-2 (AQP2) undergoes constitutive recycling between the cytoplasm and plasma membrane, with an intricate balance between endocytosis and exocytosis. By inhibiting the actin-related protein (Arp)2/3 complex, we prevented AQP2 from entering the exocytotic pathway at the post-trans-Golgi network level and blocked AQP2 membrane accumulation. Arp2/3 inhibition, therefore, enables us to separate and target the exocytotic process, while not affecting endocytosis, thus allowing us to envisage strategies to modulate AQP2 trafficking and treat water balance disorders.

INTRODUCTION

Aquaporin-2 (AQP2) is a water channel located primarily in principal cells of kidney collecting tubules, where it is vital for regulating body water homeostasis (1–4). AQP2 is subject to hormonal control, mainly via the canonical vasopressin (VP) signaling pathway, but it also undergoes constitutive recycling independent of VP (5, 6). Like other membrane proteins using the secretory pathway, AQP2 is first produced in the endoplasmic reticulum and moves through the Golgi apparatus into the trans-Golgi network (TGN). Released AQP2 transport vesicles are then shuttled to the subplasma membrane region of the cell in a microtubule-dependent manner (7) and ultimately fuse with the plasma membrane, interacting with the actin cytoskeleton throughout this process (8). The subsequent endocytosis of AQP2 from the plasma membrane is mainly mediated by clathrin-coated pits (9, 10). After internalization, AQP2 vesicles lose their clathrin coat and AQP2 enters Rab5-positive and early endosome antigen 1 (EEA1)-positive early sorting endosomes. AQP2 vesicles then have several fates, including rapid recycling to the plasma membrane, shuttling to a more complex pathway that involves a Rab11-positive recycling endosomal compartment, degradation in lysosomes, or being delivered to the TGN awaiting redirection to other compartments (6, 11). Under basal conditions, much of the intracellular AQP2 is located within recycling vesicles in the cytoplasm, and these vesicles undergo constitutive recycling between the cytoplasm and plasma membrane, with the balance between endocytosis and exocytosis determining the amount of AQP2 on the plasma membrane (9, 10, 12, 13).

This trafficking and recycling of AQP2 requires dynamic actin cytoskeletal remodeling. In addition to being a potential physical barrier beneath the plasma membrane, where apical actin depolymerization increases AQP2 membrane accumulation (14, 15), actin is associated with multiple steps in the clathrin-mediated endocytosis pathway, including coated pit formation, constriction, internalization, splitting and merging of clathrin-coated vesicles, and lateral mobility on the cell surface. Disruption of the F-actin assembly with latrunculin A or jasplakinolide results in near-complete cessation of clathrin-coated pit/vesicle dynamics (16). Statins, which inhibit the activity of a Rho GTPase involved in F-actin polymerization, induce AQP2 membrane accumulation by blocking AQP2 endocytosis (17, 18). A heat shock protein, heat shock complex 70, an actin-binding protein, binds to the COOH-terminus of nonphosphorylated AQP2 and is essential for AQP2 endocytosis (10). In addition to membrane trafficking at the cell surface, where actin may provide forces necessary for vesicle fission and/or propulsion of clathrin-coated vesicles away from the plasma membrane, actin is also associated with the endosomal recycling and sorting system (19, 20). Not only does F-actin facilitate clathrin-mediated budding from the TGN, but actin polymerization is also important in propelling some vesicles of Golgi origin into the cytoplasm, participating in trafficking from the TGN to the lysosome (21). Disruption of the actin cytoskeleton with cytochalasin D or latrunculin B can result in impaired AQP2 recycling and accumulation of AQP2 in EEA1-positive early endosomes (11). Furthermore, the role of the actin network in regulating AQP2 trafficking is even more complex than previously thought. Our prior study suggested that AQP2 may bind directly to actin (8, 22, 23) and catalyze F-actin depolymerization in the presence of VP (14, 15, 23). AQP2 also interacts with ERM (Ezrin, Radixin and Moesin) family proteins (22, 24), key in cross-linking actin filaments with the plasma membrane. To add another layer of complexity, we recently found that apical and basolateral actin networks regulate AQP2 trafficking differently (25). Finally, immunoisolated AQP2-bearing intracellular vesicles from rat inner medullary collecting ducts show the presence of a large variety of actin-related cytoskeletal proteins such as actin-related protein (Arp)2/3, β-actin and γ-actin, myosin isoforms, tubulin, Rab GTPases, and soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins (26), suggesting a complex network of proteins that interact with actin during various steps of AQP2 vesicular trafficking.

One of the crucial factors involved in actin cytoskeleton remodeling is the Arp2/3 complex. Arp2/3 is a highly conserved protein complex in eukaryotic cells and, in combination with the N-WASP/WAVE family of proteins (27–29), cortactin (30), and small G proteins, is involved in the regulation of actin cytoskeleton nucleation and assembly (31). The Arp2/3 complex is considered to be a key participant in the formation of a stable multimer of actin monomers that helps stabilize actin dimer intermediates and promotes branching of F-actin filaments (32). The Arp2/3 complex is targeted to the sites of new actin polymerization, where it binds to the side of existing filaments and nucleates the formation of new filaments that extend at a 70° angle to form a dense network of Y-branched F-actin (33). Arp2/3 is involved in a multitude of cellular processes, some of which include control of synaptic plasticity (34), regulation of ion channels (35), cell motility, cytokinesis (36), and cancer cell migration and invasion (29). In terms of intracellular protein trafficking, Arp2/3 has been implicated in the regulation of endosome shape, trafficking and recycling (37), conservation of the architecture and polarization of the Golgi, facilitation of transport carrier fission process at the TGN and plasma membrane, protein transport between the endoplasmic reticulum and Golgi, and post-Golgi protein secretion (38–45). Arp2/3 also plays an essential role in secretory cargo expulsion and integration of vesicular membranes with the plasma membrane. With its multifaceted role in cytoskeleton dynamics and protein transport as well as its close association with AQP2 vesicles (26), we were interested in examining the so far unexplored role of Arp2/3 in AQP2 trafficking. We used a highly specific inhibitor of Arp2/3, CK-666 (31, 46), whose crystal structure shows that it binds tightly to a pocket at the interface of Arp2 and Arp3, blocking the formation of the active Arp2/3 conformation, and stabilizes the inactive form of the complex, inhibiting branching of actin filaments (47, 48). However, it does not interfere with sides or ends of actin filaments or disassemble preformed actin branches (47, 49). Using this specific Arp2/3 inhibitor and siRNA, we now show that Arp2/3 has a critical role in the regulation of AQP2 trafficking and recycling.

MATERIALS AND METHODS

Cell Culture and Treatment

LLC-PK1 cells expressing c-myc-tagged AQP2 (referred to as LLC-AQP2 cells), c-myc-tagged S256D AQP2 mutation, green fluorescent protein (GFP)-tagged vasopressin V2 receptor (V2R), and LLC-PK1 cells stably expressing both c-myc-tagged AQP2 and soluble-secreted yellow fluorescent protein (YFP), a marker used to follow exocytosis (LLC-AQP2-ssYFP cells), were grown in DMEM with 10% FBS as previously described (50–53). Cells were confirmed to be mycoplasma free using DAPI staining with Vectashield/DAPI (Vector Laboratories, Burlingame, CA) before experiments. Cells were treated for 2 h with the Arp2/3 complex inhibitor CK-666 (100 μM, Sigma-Aldrich, St. Louis, MO). An equivalent volume of DMSO was added as a negative control and a mixture of VP (10 nM, Sigma-Aldrich) and forskolin (FK; 10 μM, Tocris Bioscience) as a positive control. VP/FK was added for 15 min to untreated and CK-666-treated cells to stimulate AQP2 membrane accumulation.

siRNA Transfection

LLC‐AQP2 cells were cultured to 50% confluency under the conditions described above in Cell Culture and Treatment and then transfected with 40 nM siRNA targeting Arp2 (Invitrogen, Charlestown, MA, 5′‐GACGGAGGCGGCUGUAGGUUGUUCA‐3′, Arp2 siRNA) or control CTscrambled siRNA (5′‐GACGGAGGCGUCGAUUUGUGGGUCA‐3′) using lipofectamine RNAiMAX according to the manufacturer’s protocol. Forty-eight hours after transfection, cells were lysed for RNA extraction or Western blot analysis to determine efficacy of the knockdown. Other treated cells were fixed and used for immunocytochemistry analysis.

RNA Extraction and Quantitative RT-PCR

Total RNA was isolated as previously described (54) using Qiashredder and an RNeasy Mini Kit (Qiagen, Germantown, MD). First‐strand cDNA was synthesized from 1 μg RNA using a High‐Capacity RNA‐to‐cDNA Kit (Applied Biosystems, Beverly, MA). PCRs were performed using PowerUp SYBR Green Master Mix on the QuantStudio3 Real‐Time PCR system (Applied Biosystems) using the following primers: 5′‐GGTGTTGATGACCTACCCTTCTTC‐3′ and 5′‐TGTTGCATGTGCAGGTTTTTC‐3′ (Eurofins Genomics, Louisville, KY). Transcript levels for Arp2 were measured with the following primer pairs: 5′- GGTGTTGATGACCTACCCTTCTTC-3′ and 5′-TFTTFCATGTGCAGGTTTTTC-3′ and normalized to ribosomal protein L2 (rpl2) as an internal control. The primer pairs we used for rpl2 were 5′- CGACGGCGAAAATGTCATC-3′ and 5′- GCAGACGTTGGCCTGGAT-3′.

Immunocytochemistry

Immunofluorescence assays were performed using LLC-AQP2 cells as previously described (50, 55, 56). Cells were cultured on 15 × 15-mm glass coverslips (Ted Pella, Redding, CA). After treatment, cells were fixed in PBS (0.1 M sodium phosphate buffer with 0.9% NaCl) containing 4% paraformaldehyde and 5% sucrose. For AQP2 staining alone, cells were permeabilized with Triton X-100 (0.1%, Sigma-Aldrich) and blocked in PBS and 1% BSA. AQP2 was detected using mouse anti-c-myc produced by hybridoma cells [MYC 19E10.2 (9E10) American Type Culture Collection CRL1729TM] and secondary anti-mouse IgG conjugated to Alexa 488 (10 μg/mL, Invitrogen). When costaining AQP2 with various subcellular markers, different permeabilization and blocking methods were used following extensive testing to find the optimal staining conditions in each case. They are listed separately here. After fixed cells were permeabilized with 0.25% SDS and blocked with 1% BSA, Rab 5 and Rab11 were detected using rabbit anti-Rab5 (0.92 μg/mL, Cell Signaling Technology, Danvers, MA) or rabbit anti-Rab11 (2.5 μg/mL Invitrogen), respectively, and secondary anti-rabbit IgG conjugated to Cy3 (2 μg/mL, Jackson ImmunoResearch Laboratories). Clathrin was detected using mouse anti-clathrin (2.5 μg/mL, BD Transduction Laboratories, San Jose, CA) and secondary anti-mouse IgG conjugated to Cy3 (2 μg/mL, Jackson ImmunoResearch Laboratories). Detection of TGN46 was done by permeabilizing with 0.25% SDS, blocking with 5% BSA, and incubatingwith rabbit anti-TGN46 (5 μg/mL, Sigma-Aldrich) followed by secondary anti-rabbit IgG conjugated to Cy3. For anti-rabbit lysosomal-associated membrane protein 1 (Lamp1; 5 μg/mL, Invitrogen), cells were permeabilized with 0.025% Triton X-100 and blocked with 1% BSA before incubation with primary antibody followed by secondary anti-rabbit IgG conjugated to Cy3. To costain the above cells with AQP2, we used goat anti-AQP2 (4 μg/mL, Santa Cruz Biotechnology) followed by anti-goat IgG conjugated to Alexa 488 (7.5 μg/mL, Jackson ImmunoResearch Laboratories). For EEA1 detection, we permeabilized cells with 0.5% SDS and blocked with 1% BSA followed by incubation with goat anti-EEA1 (15 μg/mL, Lifespan Biosciences, Seattle, WA) and then anti-goat IgG conjugated to Cy3 (2 μg/mL, Jackson ImmunoResearch Laboratories). These cells were costained with rabbit anti-AQP2 (1 μg/mL, Alomone Labs, Jerusalem, Israel) with secondary anti-rabbit IgG conjugated to Alexa-488 (6 μg/mL, Jackson ImmunoResearch Laboratories). For Golgi β-coat protein (β-COP) staining, we permeabilized cells with 0.1% Triton X-100 followed by 1% BSA blocking and used rabbit anti-Golgi ß-COP (2 μg/mL, Invitrogen) and secondary anti-rabbit igG conjugated to Cy3. We costained with mouse anti-c-myc. Images were acquired on a Nikon 90i epifluorescence microscope (Apo ×40, numerical aperture = 1.0, Nikon Instruments, Melville, NY) or a Zeiss LSM800 confocal microscope with an Airyscan detector (Apochromat ×63, numerical aperture = 1.4, Carl Zeiss Microscopy, White Plain, NY). All images were processed using Adobe Photoshop CS5 software (Adobe, San Jose, CA).

Cold Block and Cold Block Release Assay

The 20°C cold block assay was performed as previously described (6, 56). In brief, LLC-AQP2 cells were first grown on coverslips to 80% confluence and incubated at 20°C for 2 h by floating petri dishes containing coverslips in culture medium in a 20°C water bath in a 4°C cold room for more accurate temperature control. Cells were then fixed for immunostaining. In our cold block release assay, cells were incubated at 20°C for 2 h and then treated with either CK-666 or an equivalent volume of DMSO for 2 h. Cells were then rewarmed at 37°C for 30 min by being placed in a tissue culture incubator and fixed before immunofluorescence staining.

Kidney Tissue Preparation and Immunocytochemistry

All animal experiments were approved by the Massachusetts General Hospital Institutional Committee on Research Animal Care (Animal Protocol No. 2016N000040). Adult male Sprague–Dawley rats (Charles River Laboratories, Wilmington, MA) were housed individually and maintained in a temperature-controlled room regulated on a 12:12-h light-dark cycle with free access to water and food. Rats were fed with normal chow (Pro-Lab Isopro MPH 3000, LabDiet, St. Louis, MO) and acclimated 7 days in cages before any procedure. Kidney tissues were prepared as previously described (57, 58). In brief, rats were anesthetized with 2% isoflurane inhalation. They were perfused through the left ventricle with PBS until the kidneys were cleared of blood. Kidneys were then harvested and cut into 0.5-mm slices using a Stadie-Riggs microtome (Thomas Scientific, Swedesboro, NJ). Before treatment, all kidney slices were equilibrated for 30 min in CO₂ saturated HBSS (110 mM NaCl, 5 mM KCl, 1.2 mM MgSO₄, 1.8 mM CaCl₂, 4 mM NaOAc, 1 mM C₆H₇NaO₇, 6 mM d-glucose, 6 mM l-alanine, 1 mM NaH₂PO₄, 3 mM Na₂HPO₄, and 25 mM NaHCO₃). CK-666 (2.4 mM) diluted in DMSO or DMSO alone was added to the kidney tissues. After 2 h of incubation, tissue received either HBSS or the VP/FK mixture (10 nM/10 μM). After incubation, kidney tissues were immersed in periodate-lysine paraformaldehyde fixative initially at room temperature for at least 1 h, followed by overnight fixation at 4°C. Tissues were then rinsed five times in PBS, cryoprotected overnight in PBS containing 30% sucrose, and then covered with OCT compound 4583 (Tissue-Tek, Miles, Elkhart, IN). Cryosections (5 μm thick) were cut using a Leica 3050S Microtome (Leica Microsystems, Buffalo Grove, IL). Sections were picked up on white-frosted positive-charged slides (Thomas Scientific, Swedesboro, NJ) and stored at 4°C before immunofluorescence staining. After rehydration in PBS for 20 min, sections were incubated with 1% SDS in PBS for 5 min as an antigen retrieval step (59) followed by further PBS rinses for three times for 5 min. Sections were then incubated in Background Buster (Innovex Biosciences, Richmond, CA) for 5 min followed by incubation in PBS containing 1% BSA for 10 min to block nonspecific staining. Sections were incubated with rabbit anti-AQP2 antibody (1 μg/mL, Alomone Labs) overnight, washed three times for 5 min in PBS, incubated with donkey anti-rabbit IgG conjugated to Alexa 488 (6 μg/mL, Jackson ImmunoResearch Laboratories) for 1 h at room temperature, and finally rinsed three times in PBS. Arp2 was detected in the same rat kidney sections using mouse anti-Arp2 antibody (FMS96, 6 μg/mL, Abcam) and secondary anti-mouse IgG conjugated to Cy3 (2 μg/mL, Jackson ImmunoResearch Laboratories). Sections were mounted in Vectashield (Vector Laboratories), and images were acquired using a Zeiss LSM800 confocal microscope with an Airyscan detector (Apochromat ×63, numerical aperture = 1.4).

Endocytosis Assay

The endocytosis assay was performed using LLC-AQP2 cells grown on glass coverslips until 80% confluence. Drugs were added as described above in Cell Culture and Treatment, and methyl-β-cyclodextrin (MβCD; 50 mM, Sigma-Aldrich) was used as a positive control to block endocytosis (60). After treatment, cells were incubated with a rhodamine-tagged transferrin ligand (1 mg/mL, Invitrogen) for 15 min to monitor clathrin-mediated endocytosis. Cells were then washed twice with cold PBS before being fixed in 4% paraformaldehyde and 5% sucrose solution, and images were acquired using a Nikon 90i epifluorescence microscope (Apo ×40, numerical aperture = 1.0).

Exocytosis Dot-Blot Assay

Exocytosis was quantified in LLC-PK1 cells stably expressing both c-myc-tagged AQP2 and ssYFP (LLC-AQP2-ssYFP cells). Cells were grown in 24-well plates (Corning, Corning, NY) until 80% confluency. Drugs were added as described above in Cell Culture and Treatment. At the end of the treatment, 250 μL of medium (supernatant) was collected from each well. Soon after collection, the supernatant of each well was loaded onto Bio-Dot microfiltration units (Bio-Rad Laboratories, Hercules, CA), and proteins in the supernatants were transferred onto Immun-blot PVDF membranes (Bio-Rad). Membranes were blocked in PBS with 1% Tween 20 (PBS-T) containing 5% nonfat milk for 1 h at room temperature. Membranes were incubated overnight with primary antibodies. The primary antibody was rabbit anti-GFP (Invitrogen), which can detect and bind ssYFP protein (53). Membranes were then washed five times in PBS-T before second antibody incubation with horseradish peroxidase-conjugated antibodies (Jackson ImmunoResearch Laboratories). Signals were visualized using enhanced chemiluminescence Western Lightning ECL (Amersham, Arlington Heights, IL). The intensity signal on the membranes was acquired using the imaging system G-box mini and GeneSys image acquisition software (Syngene, Frederick, MD). Intensities of ssYFP were analyzed by Genesys Software (Genesys, Daly City, CA). Values represent at least three independent experiments, with results at each time point measured in triplicate.

Western Blot Analysis

Western blot analysis was performed as previously described (54, 61). Briefly, LLC-AQP2 cells were grown to 90% confluency. Cells were incubated with CK-666 or DMSO for 120 min, followed by 15-min VP/FK. Here, cells were lysed in RIPA buffer supplemented with a Complete protease inhibitor cocktail (Sigma-Aldrich), EDTA (5 mM), and phosphatase inhibitors NaF (1 mM) and sodium orthovanadate (1 mM). Protein concentrations were determined using the bicinchoninic acid (BCA) kit according to the manufacturer’s instructions (Pierce, Rockford, IL). Solubilized proteins (20 μg) were mixed with NuPage SDS sample buffer and incubated at 75°C for 10 min. Samples were run on a NuPage 4–12% bis-Tris gel (Invitrogen) and transferred on to Immun-blot PVDF membranes (Bio-Rad). Membranes were blocked in PBS-T containing 5% nonfat milk for 1 h at room temperature. Membranes were incubated overnight with primary antibodies against rabbit anti-AQP2, anti-phospho-pS261 AQP2 (1:1,000, Symansis, Temecula, CA), anti-phospho-pS269 AQP2 (1:1,000, Symansis), and anti-phospho-pS256 AQP2 (1 μg/mL, Abcam). Membranes were then washed five times in PBS-T before second antibody incubation with horseradish peroxidase-conjugated antibodies (0.08 μg/mL, Jackson ImmunoResearch Laboratories). Intensities of phosphoproteins were corrected according to the amount of total AQP2 on the same membrane.

Arp2 expression in LLC-AQP2 cells transfected with either siArp2 or CT scrambled siRNA was determined by Western blot analysis. Arp2 was detected using the mouse anti-Arp2 antibody (FMS96, 480 ng/mL, Abcam) in Tris-buffered saline and 0.1% Tween 20. Intensities of Arp2 proteins were corrected to the amount of monoclonal α-tubulin antibody (TU-02, 0.4 μg/mL, Santa Cruz Biotechnology) on the same membrane. Signals were visualized using enhanced chemiluminescence Western Lightning ECL (Amersham). The intensity signal on the membranes was acquired using the imaging system G-box mini and GeneSys image acquisition software (Syngene). After visualization, membranes were stripped using Western blot stripping buffer (ThermoFisher Scientific, Rockford, IL) for 10 min according to the manufacturer’s instructions and reincubated with different primary antibodies as previously listed.

Quantification of AQP2 at the Plasma Membrane

The accumulation of plasma membrane AQP2 was quantified as previously described (25, 61). In brief, after AQP2 labeling, cell membranes were costained with rhodamine-conjugated wheat germ agglutinin (2 μg/mL, Lectin Kit, Vector Laboratories) for 8 min. Cells were washed three times with PBS and mounted with Vectashield with DAPI to costain the nucleus. Quantification of AQP2 was performed under blinded conditions. The fluorescence channel corresponding to AQP2 staining was shut off, and the membrane and cytoplasmic areas were determined by fluorescence labeling performed using the rhodamine-conjugated wheat germ agglutinin signal. In this way, we determined a region of interest corresponding to the membrane, cytoplasm, and nucleus of each cell. The fluorescence in the AQP2 channel was then evaluated in each predetermined region of interest and corrected for nonspecific labeling by subtraction of the background fluorescence observed in the nucleus. The mean fluorescence intensity of the plasma membrane area was determined using 30 cells from five different images of each sample taken and quantified using Volocity software (Quorum Technologies). Each experiment was repeated at least three times.

Data Analysis

Images of immunocytochemistry were analyzed using Volocity (Quorum Technologies). Western blot results were quantified with ImageJ (National Institutes of Health, Bethesda, MD). Data are expressed as means ± SD. Statistical analyses were performed as appropriate using one-way ANOVA with multiple comparisons tests with the Tukey correction; t tests were used when applicable. Differences were considered to be significant at P < 0.05. Specific P values are given in the figures.

RESULTS

The Arp2/3 Complex Is Highly Expressed in the Kidney Collecting Duct, Where It Colocalizes With AQP2

Although Arp2/3, represented by Arp2 here, is a ubiquitously expressed protein, its expression is stronger in the collecting duct than in other parts of the kidney tubules. Arp2 is strongly expressed in both basolateral and apical plasma membranes of principal cells in the papilla (Fig. 1, left, green). In the outer medulla (Fig. 1, middle) and cortex (Fig. 1, right), Arp2 expression was more intense on the apical membrane than at the basolateral pole of principal cells. AQP2 (Fig. 1, red) staining, as previously shown, had a similar distribution to Arp2; more specifically, a mostly (but not exclusively) apical distribution in the cortex and outer medulla but both apical and basolateral expression in the papilla. The similar distribution of Arp2 and AQP2 along the collecting duct in different regions of the kidney suggests a possible role of Arp2/3 in AQP2 trafficking, and this prompted us to further to investigate the role of Arp2/3 in this process.

Figure 1.

Actin-related protein (Arp)2 is highly expressed in renal collecting duct principal cells, where it colocalizes with aquaporin-2 (AQP2) in both apical and basolateral membranes. Arp2 is highly expressed on both apical and basolateral membranes of renal inner medullary principal cells (green, left), but is mostly on the apical membrane in the outer medulla and cortex (green, middle and right). AQP2 is expressed mostly (but not exclusively) at the apical pole of principal cells in the cortex and outer medulla but shows strong apical and basolateral staining in the inner medulla (red, top row). AQP2 colocalizes with Arp2 in these different regions along the collecting duct. This entire image was enhanced and sharpened using a high-pass filter in Adobe Photoshop. These images are representative of the staining performed in three different animals. Scale bar = 10 µm.

CK-666, an Arp2/3 Inhibitor, Inhibits VP-Induced AQP2 Membrane Accumulation

The localization of AQP2 shifted from cytoplasmic to the plasma membrane upon a 15-min VP/FK treatment of LLC-PK1 cells stably transfected with AQP2, as expected (Fig. 2, A vs. B). This shift of AQP2 localization was abolished when cells were pretreated for 2 h with CK-666, an Arp2/3 inhibitor (Fig. 2, C and D). Moreover, CK-666 caused AQP2 to accumulate in perinuclear vesicles and form perinuclear patches in many cells, an effect that was especially noticeable when VP/FK was coadministered (Fig. 2D). To confirm the effect of CK-666 on AQP2 distribution, we knocked down Arp2 using siRNA (siArp2). After 48 h, we observed a significant 60% reduction of Arp2 protein expression compared with control (siControl; Fig. 2F). Similar to the effect of CK-666 (Fig. 2, C and D), knockdown of Arp2 caused a shift in AQP2 distribution from cytoplasmic to a more compact patch in the perinuclear region in many cells (Fig. 2, J and K). Furthermore, the AQP2 membrane accumulation normally induced by VP was also inhibited in cells treated with siArp2 (Fig. 2, K vs. I). Although these effects confirmed those seen using CK-666, they were not as pronounced as with the inhibitor, presumably because of the incomplete knockdown of Arp2. Due to the inhibitory effect of CK-666 and siRNA Arp2 knockdown on VP/FK-induced AQP2 membrane localization, we further explored whether the functionally important AQP2 phosphorylation induced by VP was also affected by Arp2/3 inhibition.

Figure 2.

Pretreatment with CK-666, an actin-related protein (Arp)2/3 inhibitor, or downregulation of Arp2 expression using siRNA induces dense perinuclear accumulation of aquaporin-2 (AQP2) and inhibition of vasopressin (VP)/forskolin (FK)-induced AQP2 membrane accumulation. AQP2 was located on the intracellular vesicles under baseline CT conditions (A) and accumulated in the plasma membrane after VP/FK treatment for 15 min (B). After CK-666 treatment alone for 2 h (C), many cells showed a coarse, granular AQP2 staining pattern in the cytoplasm as well as a small, dense perinuclear patch of staining (arrows). CK-666 pretreatment prevented the VP/FK-induced membrane accumulation of AQP2 (D) that was evident in B. Instead, dense, punctate perinuclear accumulation of AQP2 was seen (D, arrows). Quantification of the membrane AQP2 (E) confirmed that CK-666 significantly blocked VP-induced AQP2 membrane accumulation. Each dot is an average of >30 cells (means ± SD, significant when P < 0.05). Western blot analysis (F) showed that Arp2 protein expression in LLC‐AQP2 cells decreased significantly when cells were transfected with Arp2 siRNA (siArp2; 40 nM) for 48 h. Quantification of the band intensities showed a significant reduction in cells treated with siArp2 (G). The immunocytochemistry results showed that transfection with 40 nM of scrambled (CT) siRNA did not induce significant morphological changes in our cells (H). However, cells transfected with siArp2, similar to cells treated with CK-666, formed dense, punctate perinuclear accumulations of AQP2 (J), and VP/FK-induced AQP2 membrane accumulation (I) was greatly reduced (K). These images are representative of staining performed in three separate experiments. Scale bar = 10 µm. The quantification for Western blot analysis (G) was the average of three independent experiments in triplicates (means ± SD, n = 3, *P = 0.0016). CT, control; LLC‐AQP2, LLC-PK1 cells expressing c-myc-tagged AQP2.

Arp2/3 Inhibition Does Not Affect the Phosphorylation State of AQP2, and Its Action Is Independent of S256 Phosphorylation

We examined the effect of CK-666 on the phosphorylation state of AQP2 induced by VP/FK to determine whether the inhibition of AQP2 membrane accumulation by CK-666 was caused by altered AQP2 phosphorylation. As shown in previous studies (54, 61), VP results in phosphorylation of AQP2 at S256 and S269 residues and dephosphorylation at residue S261. Using Western blot analysis, we demonstrated that CK-666 did not alter AQP2 phosphorylation in the basal state, nor did it alter the AQP2 phosphorylation pattern upon VP/FK stimulation (Fig. 3, A and B). Since S256 is the major regulator of AQP2 membrane accumulation, we applied CK-666 to our S256D AQP2 mutant cell lines. These cells mimic constant phosphorylation of AQP2 at S256, and AQP2 is mostly retained at the plasma membrane even under baseline conditions (12, 56). Here, we showed that, unexpectedly, Arp2/3 inhibition caused S256D AQP2 to redistribute almost completely into the cytoplasm within 2 h of treatment (Fig. 3, C−F), suggesting that the effect of CK-666 is independent of S256 phosphorylation. Because S256D AQP2 accumulation in the plasma membrane is mainly due to its resistance to endocytosis (12, 56), this result prompted us to investigate whether there might be an alteration of the balance between AQP2 endocytosis and exocytosis upon Arp2/3 inhibition that might explain its effect on S256D AQP2 localization.

Figure 3.

CK-666 does not affect vasopressin (VP)-induced aquaporin-2 (AQP2) S256 and S269 phosphorylation and S261 dephosphorylation. However, CK-666 inhibits constitutive membrane accumulation of S256D mutant AQP2 that is constantly phosphorylated at S256. A: Western blots using specific phospho-AQP2 antibodies were performed on lysates from LLC-AQP2 cells. VP increased S256 and S269 phosphorylation and induced S261 dephosphorylation significantly, as expected. CK-666 pretreatment did not affect the VP-induced change of phosphorylation state. This result was representative of three independent experiments performed in duplicate. The phosphoserine band intensities (B) were normalized by their respective total AQP2 (tAQP2) loading controls and represented in histogram form where each dot represents an independent experiment (means ± SD, significant when P < 0.05). Cells expressing the S256D AQP2 mutant mimicking constant phosphorylation of AQP2 at S256 showed constitutive AQP2 accumulation at the plasma membrane (C). There was no change in localization upon VP/forskolin (FK) treatment (D). CK-666 treatment for 2 h, however, resulted in an almost compete loss of plasma membrane AQP2 staining (E). Instead, AQP2 was localized in intracellular vesicles, and many cells showed a small, dense perinuclear patch of AQP2 staining similar to those observed in cells expressing wild-type AQP2 in Fig. 2 (arrows). There was no change in localization of S256D AQP2 upon VP/FK exposure in these CK-666-treated cells (F). These images are representative of staining performed in more than three separate experiments done in triplicate. Scale bar = 10 µm. LLC‐AQP2, LLC-PK1 cells expressing c-myc-tagged AQP2.

Arp2/3 Inhibition Does Not Affect the Endocytotic Pathway

For CK-666 to induce intracellular accumulation and block VP-induced membrane accumulation of AQP2, we hypothesized that CK-666 either accelerates endocytosis or decreases exocytosis. Therefore, we began by examining the endocytosis arm of the pathway. It is known that AQP2 recycles from the cell surface back to the cytoplasm via clathrin-mediated endocytosis, similar to transferrin and V2R (9, 62–66). To examine whether CK-666 inhibits AQP2 membrane accumulation through altered endocytosis, we performed a rhodamine-conjugated transferrin endocytosis assay (Fig. 4A) and a V2R endocytosis assay (Fig. 4B). In cells treated with CK-666, we did not observe any significant difference in the total endocytosed rhodamine-transferrin signal compared with CT (Fig. 4A, left). In contrast, our positive control, MβCD, a general endocytosis blocker, caused an intense linear accumulation of transferrin at the plasma membrane (Fig. 4A, right). This result suggested that CK-666 did not decrease clathrin-mediated endocytosis. We then used our GFP-tagged V2R cell model. At baseline, V2R accumulates in the plasma membrane, and, with VP treatment, we observed a marked internalization of V2R-GFP, as previously described (50, 67). This suggests that the clathrin-mediated endocytosis process that is necessary for receptor downregulation after ligand binding still occurs when Arp2/3 activity is inhibited (Fig. 4B). However, CK-666 treatment itself did not induce V2R internalization and did not affect the internalization of V2R-GFP induced by VP (Fig. 4B, inset). This result indicates that CK-666 did not block or accelerate clathrin-mediated endocytosis of V2R. Combining the observations from these two sets of experiments, we conclude that Arp2/3 blockade does not alter the clathrin-mediated endocytic pathway. We next examined the remaining hypothesis that Arp2/3 blockade inhibits exocytosis.

Figure 4.

CK-666 does not inhibit endocytosis of transferrin or green fluorescent protein (GFP)-tagged vasopressin (VP) V2 receptor (V2R), whereas CK-666 does inhibit the exocytosis pathways of secreted soluble yellow fluorescent protein (ssYFP) and aquaporin-2 (AQP2). A: after incubation under baseline conditions, Rho-transferrin was mostly localized in the cytoplasm, indicating that it was internalized into cytoplasmic vesicles. Rho-transferrin was also mostly intracellular after CK-666 preincubation. In contrast, our positive control drug, methyl-β-cyclodextrin (MBCD), a nonspecific blocker of endocytosis, caused marked membrane accumulation of transferrin (red) as the probe bound to receptors on the cell surface but failed to be internalized. B: V2R conjugated with GFP expressed in LLC-PK1 cells was present on the cell surface under baseline conditions and was rapidly internalized into the cytoplasm upon VP/forskolin (FK) treatment (inset). CK-666 alone did not induce V2R internalization, and, furthermore, this actin-related protein 2/3 inhibitor did not affect VP-induced V2R internalization. Using a dot-blot assay, ssYFP band intensities in samples of cell culture media were reduced upon CK-666 treatment of LLC-ssYFP cells compared with untreated cells (CT; C). The bands were on the same immunoblot membrane but are labeled separately here for clarity. This result was representative of four independent experiments performed in triplicate. The quantification showed a significant 40% reduction of secretion. The bands shown here in A were taken from the same membrane run and processed at the same time. The graph is expressed as means ± SD (P = 0.006, unpaired t test). By immunocytochemistry (D), we observed that perinuclear AQP2 patches were formed in cells incubated at 20°C (cold block) for 2 h. By rewarming the cells to 37°C, these perinuclear patches dissipated, and AQP2 quickly redistributed throughout the cytoplasm (cold block release). However, in cells pretreated with CK-666, AQP2 patches failed to dissipate upon rewarming (right bottom). These images are representative of staining performed in more than three separate experiments done in triplicate. Scale bar = 10 µm.

CK-666 Inhibits the Exocytosis Pathway

We have previously shown that detection of transfected ssYFP in the growth medium of LLC-PK1 cells is a reliable marker of vesicle exocytosis (53, 68). In previous publications, we followed exocytosis by monitoring the amount of ssYFP fluorescence in media samples taken at various time points after VP stimulation (54, 55, 61). However, our initial experiments using this fluorescence detection method were not successful, because CK-666 has a high intrinsic autofluorescence that confounded data interpretation. Therefore, we developed a different assay based on detection of ssYFP protein in the medium by blotting with anti-GFP antibodies that cross react with YFP. As shown in Fig. 4C, this new assay showed a highly significant 40% reduction in the secretion of ssYFP from cells treated with CK-666 under baseline conditions. This result suggests that CK-666 inhibits the constitutive exocytosis pathway that is necessary to replenish plasma membrane AQP2 during the recycling process (Fig. 4C).

We then studied the effect of CK-666 on the exocytosis pathway using a second method. Lowering the temperature of cells to 20°C allows AQP2 endocytosis to continue but prevents protein exit from the TGN in the exocytosis arm of the recycling process, inducing formation of a distinct perinuclear AQP2 patch (Fig. 4D, top right) (6, 56). When the incubation temperature was returned to 37°C (cold block release; Fig. 4B, bottom left), there was a rapid dissipation of the tight perinuclear patches, and AQP2 rapidly redistributed into vesicles scattered throughout the cytoplasm, as it enters the post-TGN exocytotic pathway (6, 56). Importantly, this phenomenon was not observed in cold-exposed cells that had been treated with CK-666 before rewarming; AQP2 remained in well-defined perinuclear patches even after cold block release. This finding suggests that the release of AQP2-containing vesicles from the TGN region and ultimately their delivery to the plasma membrane is blocked by CK-666. Next, we treated our LLC-PK1 cells that stably expressed both AQP2 and ssYFP (LLC-AQP2-ssYFP) with CK-666, and we found that both AQP2 and ssYFP colocalized and again formed distinct perinuclear patches (Fig. 5). These data again indicate that the TGN-associated exocytic pathway is inhibited upon Arp2/3 blockade. Based on this information, we further examined AQP2 colocalization with several cell compartment markers that would help determine the identity of the vesicles that contain AQP2 in these different conditions.

Figure 5.

CK-666 causes accumulation of aquaporin-2 (AQP2) and secreted soluble yellow fluorescent protein (ssYFP; a marker of the secretory pathway) in a perinuclear patch. YFP is shown in green; AQP2 is shown in red. CK-666 induced perinuclear accumulation of vesicles in small patches, and many of the vesicles forming these patches contained both ssYFP and AQP2, consistent with CK-666 blocking the secretory/exocytotic pathway. These images are representative of staining performed in more than three separate experiments done in triplicates. Scale bar = 10 µm.

AQP2 Mainly Accumulates in Clathrin-Positive, TGN-Associated Vesicles Upon ARP2/3 Inhibition

After CK-666 or siRNA treatment, AQP2 and some of the other compartment markers (clathrin, Rab11, Rab5, and LAMP-1) were redistributed into a tighter perinuclear patch. However, although there was an appearance of colocalization of these markers with AQP2 using wide-field microscopy (Figs. 6A and 7A), higher resolution Airyscan confocal imaging revealed that the major perinuclear compartment in which AQP2 accumulated colocalized with clathrin staining (Fig. 6B). For the most part, AQP2 and Rab11 were not obviously located in the same vesicles (Fig. 7B). Similar colocalization of AQP2 with clathrin-positive (Fig. 6B), but not Rab11-positive, vesicles was also seen in cells before and after cold block and release and in S256D cells treated with CK-666 (Fig. 7B). Because clathrin is widely thought to be associated with TGN-associated vesicles, we costained our cells with other Golgi and TGN markers to further delineate the location of these AQP2 vesicles using Airyscan confocal microscopy.

Figure 6.

Aquaporin-2 (AQP2) in cells pretreated with CK-666 and actin-related protein (Arp)2 knockdown localizes in perinuclear, clathrin-positive vesicles. Using wide-field microscopy, clathrin at baseline was partially concentrated in a perinuclear position (A, top) but became much more compact, in a smaller patch, after CK-666 treatment, overlapping with AQP2 in the patch (A, bottom). Using higher resolution Airyscan confocal imaging, clear evidence of AQP2/clathrin colocalization can be seen, as illustrated by the yellow color of many vesicles in the merged panels. Similar colocalization was seen after siRNA-induced downregulation of Arp2 (B, II), CK-666 treatment after cold block (CB) release (B, III), and, to a lesser extent, in S256D cells (B, IV). These images are representative of more than five independent experiments for each subcellular marker. Scale bar = 10 µm for A and 2 µm for B.

Figure 7.

Aquaporin-2 (AQP2) shows little overlap with Rab11 in cells pretreated with CK-666 and upon actin-related protein (Arp)2 knockdown. Under baseline conditions, Rab11 (red) was already in small perinuclear clusters in LLC-AQP2 cells (A, top), but after CK-666 treatment the clusters seemed smaller and more compact with partial colocalization with AQP2 at low magnification using wide-field imaging (A, green). However, higher resolution Airyscan confocal images (B) revealed that colocalization was minimal after CK-666 treatment, and that despite being in proximity in the perinuclear patches, AQP2- and Rab11-positive vesicles were distinct structures. Similar tight perinuclear patches of Rab11 and AQP2 were seen with knockdown of Arp2 (B, II), CK-666 treatment after cold block (CB) release (B, III), and in S256D cells (B, IV). Once again, however, these markers were located in distinctly separate vesicles. LLC‐AQP2, LLC-PK1 cells expressing c-myc-tagged AQP2.

AQP2 Does Not Colocalize With Golgi Markers After Arp2/3 Inhibition

Under baseline conditions, AQP2 was dispersed throughout the cytoplasm, whereas the Golgi markers GM130 (cis-Golgi marker; Fig. 8A), β-COP (Golgi complex marker; Fig. 8B), and TGN46 (TGN marker; Fig. 8C) were located in the perinuclear regions, in LLC-AQP2 cells. After CK-666 treatment, AQP2 vesicles formed a compact perinuclear patch, as previously shown (green, bottom left), whereas GM130-positive, β-COP-positive, and TGN46-positive perinuclear vesicles were scattered around these AQP2 patches. Using Airyscan imaging, AQP2 was clearly located in distinctly different vesicles from those that were positive for the three Golgi markers. These results suggest that the tight AQP2 patches are not in the Golgi apparatus or part of the TGN that contains TGN46 protein. However, our observation that vesicles positive for Golgi markers disperse markedly after Arp2/3 inhibition confirms the important role of Arp2/3 in stabilizing Golgi architecture and polarization, as previously reported (69).

Figure 8.

Aquaporin-2 (AQP2) does not colocalize with vesicles stained with Golgi markers including GM130 (A), β-COP (B), and TGN46 (C). Under baseline conditions, AQP2 was dispersed throughout the cytoplasm, whereas GM130 (a marker of the cis-Golgi), β-COP (a marker of the Golgi complex), and TGN46 (a marker of the trans-Golgi network) were located in the perinuclear regions in LLC-AQP2 cells. After CK-666 treatment, AQP2 staining became a compact perinuclear patch (green, bottom left), whereas the GM130-positive, β-COP-positive, and TGN46-positive vesicles scattered around the AQP2 patches in distinctly different vesicles. These images are representative of staining performed in more than three separate experiments done in triplicates. Scale bar = 2 µm. LLC‐AQP2, LLC-PK1 cells expressing c-myc-tagged AQP2.

AQP2 Does Not Colocalize With Rab5-Positive or EEA1-Positive Early Endosomes or Lysosomes After Arp2/3 Inhibition

At baseline, there was a small overlap of AQP2 in Rab5-positive and EEA1-positive early endosomes and LAMP-1-postive lysosomes, as expected based on its trafficking itinerary (Fig. 9, A–C, top). After treatment with CK-666, when AQP2 formed a distinct perinuclear patch, there was no apparent increase in overlap with Rab5-positive, EEA1-positive, or LAMP-1-positive vesicles. EEA1-positive early endosomes did not seem to shift their localization after CK-666 treatment; in contrast, Rab5-positive and LAMP-1-positive structures (which probably include late endosomes as well as lysosomes) accumulated into a tighter perinuclear patch compared with untreated cells (Fig. 9, A and C, bottom).

Figure 9.

Aquaporin-2 (AQP2) does not colocalize with Rab5-associated, early endosome antigen 1 (EEA1)-associated, or lysosomal-associated membrane protein 1 (LAMP-1)-positive vesicles. Under baseline conditions, AQP2 was dispersed throughout the cytoplasm with only slight colocalization with vesicles positive with Rab5 (A, top, red), EEA1 (B, top, red), and lysosomes (C, top, red). With CK-666 treatment, AQP2 formed a perinuclear patch, as previously shown (green), and Rab5 (A, bottom) and LAMP-1 (C, bottom) seemed to reorganize and concentrate at least partially in the perinuclear regions, whereas EEA1 did not obviously change its localization (B, bottom). Regardless of their locations, these markers showed little to no apparent overlap or colocalization with AQP2. These images are representative of staining performed in more than three separate experiments done in triplicates. Scale bar = 2 µm.

CK-666 Inhibits VP-Induced AQP2 Membrane Accumulation in Kidney Principal Cells In Situ

As previously described (58), AQP2 redistributed from the cytoplasm to apical membranes upon VP treatment of rat kidney slices in vitro (Fig. 10, top). This shift of AQP2 upon VP treatment was, however, no longer observed when kidney slices were pretreated with CK-666 (Fig. 10, bottom right), similar to the observations in our cell model (see Fig. 2). Instead, upon CK-666 treatment, AQP2 was more diffusely distributed in the cytoplasm both under baseline incubation conditions and also upon VP treatment, often forming large, coarse aggregates of vesicles that were similar to those seen in cell cultures (Fig. 10, bottom).

Figure 10.

CK-666 blocks vasopressin (VP)-induced apical membrane accumulation of aquaporin-2 (AQP2) in collecting duct principal cells in kidney slices. In kidney slices incubated in vitro, AQP2 was located mostly in the cytoplasm under baseline CT conditions and accumulated in the apical membrane after VP treatment (arrows, top right) as expected. CK-666 pretreatment prevented this VP-induced apical membrane accumulation of AQP2 (bottom right), and instead AQP2 diffusely distributed in the cytoplasm, where it formed coarse spots and larger patches. These images are representative of staining performed in three different animals. Scale bar = 10 µm. CT, control.

DISCUSSION

In this study, we revealed the critical role of the Arp2/3 complex in the AQP2 exocytotic pathway. The specific Arp2/3 inhibitor CK-666 halts AQP2 exocytosis by blocking AQP2 trafficking at the point of exit from the TGN compartment. These results were confirmed using siRNA knockdown of Arp2 in our cell culture model. Arp2/3 inhibition does not, however, affect the endocytic pathway, and it is independent of the phosphorylation state of AQP2.

Actin cytoskeleton dynamics are a major determinant of AQP2 trafficking. We and others have previously shown that AQP2 is necessary for VP/FK-mediated filamentous actin depolymerization and AQP2 membrane accumulation in cultured renal epithelial cells (14, 23). Many proteins and cofactors are involved in modulating actin polymerization and depolymerization (70–72). One of them, the Arp2/3 complex, is associated with intracellular AQP2 vesicles in inner medullary collecting duct cells (26), but its role in AQP2 trafficking has been unclear. Arp2/3 is a key actin filament nucleation factor that rapidly assembles distinctive branched filament networks. It has diverse roles in cell motility, division, invasion, membrane invagination of endocytic vesicles, recycling, and intracellular membrane organization and vesicular transport. Arp2/3-branched actin in other cell models has been shown to maintain an active pool of GTP-RhoA and controls RhoA abundance. Arp2/3 inhibition with CK-666 reduced RhoA activity (73). We and others have previously shown that downregulation of RhoA activity with statins results in actin depolymerization. AQP2 endocytosis was inhibited, and AQP2 accumulated at the plasma membrane after statin treatment of both cultured cells and kidney principal cells in vivo, resulting in a reduction of urine volume and an increase in urine concentration in rats and mice with diabetes insipidus (17, 18). Our present study, however, shows that CK-666 alone does not cause AQP2 membrane accumulation despite its effect on Arp2/3 and does not seem to inhibit clathrin-mediated endocytosis. This is consistent with prior findings that disrupting the actin cytoskeleton in different mammalian cell lines causes heterogeneous effects and induces varying degrees of inhibition of clathrin-mediated endocytosis, especially when there are differences in membrane tension and sizes of cargo to be endocytosed (74). Our result may also suggest that Arp2/3 plays a multifaceted role in AQP2 vesicular trafficking instead of a distinct function on one arm of trafficking. The summation of Arp2/3 inhibition on AQP2-associated vesicles is a reduction of exocytotic trafficking to the plasma membrane and retention of AQP2 in a perinuclear compartment that colocalizes with clathrin. Previous works on the effect of actin and AQP2 trafficking have clearly shown that actin depolymerization causes increased AQP2 membrane accumulation. At the time, the data were reasonably interpreted as an increase in AQP2 exocytosis (75). However, in light of more recent work showing the important role of endocytosis in determining AQP2 plasma membrane residence time (9, 12, 18, 22, 23, 25, 60), we suggest that the effects seen in earlier studies could equally well be due to the inhibitory effect of actin depolymerization on AQP2 endocytosis.

The release of vesicles from the TGN into the exocytotic pathway involves a process that is topographically similar to endocytosis from the cell surface. In many cases, clathrin is involved; hence, the finding of increased concentration of clathrin at the level of the TGN by immunocytochemistry (21, 76–78). Thus, failure of actin to polymerize at sites of vesicle budding from the TGN could very well impede the overall process of protein delivery into the exocytotic pathway, similar to the effect on endocytosis from the cell surface (79). In our study, we showed that Arp2/3 inhibition halts post-TGN AQP2 transport and that AQP2 is trapped in what are probably TGN-associated clathrin-coated vesicles that are unable to bud off for membrane transport. Interestingly, the well-known TGN marker TGN46 (formerly referred to as TGN38) did not colocalize with AQP2 after CK-666 blockade. Nor did other Golgi markers, GM130 and β-COP. This suggests that the TGN46 and clathrin-labeled compartments are distinct membrane domains in the TGN region. Furthermore, we were not able to detect colocalization with another perinuclear compartment, i.e., LAMP-1-positive vesicles that include late endosomes and lysosomes. This indicates that despite a trafficking blockade, AQP2 was not diverted into the degradative pathway by Arp2/3 inhibition.

However, we also show here that the plasma membrane endocytosis mechanism is not affected by Arp2/3 inhibition, implying that different actin-related mechanisms are in place at these different cellular locations. This would not be surprising, since there is considerable evidence in other systems that different cellular pools of actin are differentially regulated (80–82), including apical and basolateral pools in the epithelial cells (83), and including these pools in AQP2-expressing cells (25). Deletion of Arp2/3 affects specific intracellular protein trafficking events but not other important functions of actin (84). Furthermore, the Arp2/3 complex has been shown to concentrate in the proximity of the membrane of trans-Golgi cisternae (21, 43), supporting our observation that CK-666 inhibition arrests the release of AQP2-containing vesicles from the TGN region. Overall, our data suggest that Arp2/3-mediated actin polymerization is more important for remodeling intracellular actin networks in the peri-Golgi area than for regulating actin in the cell periphery (39). This finding was unexpected based on our immunofluorescence data showing colocalization of Arp2 and AQP2 in an apparent plasma membrane location in principal cells, which could reflect other functions of Arp2/3 at the plasma membrane that were not detected in our experiments.

Another interesting finding from our study is that in S256D AQP2 cells, in which the rate of AQP2 endocytosis is lower than in cells expressing wild-type AQP2, most of the AQP2 is expressed at the plasma membrane at baseline (12, 56). Despite baseline membrane expression, there is still an intrinsic rate of constitutive recycling even in these cells, and most of the AQP2 was located inside the cell after Arp2/3 inhibition for 2 h. This not only confirmed that the action of CK-666 is independent of S256 phosphorylation but also indicates that CK-666 does not greatly affect endocytosis. The observation that S256D AQP2 is mostly cytoplasmic after CK-666 treatment could be explained by effective blockade or reduction of AQP2 exocytosis after 2 h, in the continued presence of endocytosis, albeit slower than that for wild-type cells (56). This altered recycling equilibrium would ultimately result in the observed mainly cytoplasmic localization of S256D AQP2. But because of the slower rate of endocytosis of the S256D AQP2, some AQP2 would still retain at the membrane after 2 h (Fig. 3, E and F).

In summary, our study reveals a role of Arp2/3 in AQP2 vesicular trafficking at the level of exocytosis from the post-TGN compartment. It also indicates that we can unilaterally block AQP2 exocytosis without an apparent effect on endocytosis. This suggests that more targeted control of AQP2 trafficking is feasible to regulate its plasma membrane expression.

GRANTS

This work was supported by the National Institutes of Health (NIH) Grant DK096586 (to D.B.). P.W.C. was supported by NIH K-award DK115901 and a generous philanthropic gift from Donald Glazer. C.-C.S.L. was supported by NIH Training Grant 5T32DK007540. The authors also received support from the Program in Membrane Biology Core that houses the Nikon A1R confocal platform and Zeiss LSM 800 with Airyscan confocal, which were purchased using NIH Shared Instrumentation Grants 1S10RR031563-01 and 1S10OD021577-01 (to D.B.), respectively. Additional support for the Program in Membrane Biology Microscopy Core came from the Boston Area Diabetes and Endocrinology Research Center (DK057521) and the Massachusetts General Hospital Center for the Study of Inflammatory Bowel Disease (DK043351).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

C.-C.S.L., P.W.C., R.B., and D.B. conceived and designed research; C.-C.S.L., P.W.C., A.D., N.B., T.C.P., and R.B. performed experiments; C.-C.S.L., P.W.C., A.D., T.C.P., A.V.N., R.B., and D.B. analyzed data; C.-C.S.L., P.W.C., N.B., R.B., and D.B. interpreted results of experiments; P.W.C., A.D., N.B., A.V.N., and R.B. prepared figures; C.-C.S.L. and P.W.C. drafted manuscript; P.W.C., R.B., and D.B. edited and revised manuscript; P.W.C., A.D., and D.B. approved final version of manuscript.