| Antibodies |
| Alix |
Santa Cruz |
Cat#: sc-53540 RRID:AB_673819
|
| CALR; Calreticulin |
Cell Signaling Technology |
Cat#: 12238 RRID:AB_2688013
|
| Catalase |
Santa Cruz |
Cat #: sc-271803 RRID:AB_10708550
|
| CD9 |
BD Biosciences |
Cat #: 553758 RRID:AB_395032)
|
| CD81 |
Santa Cruz |
Cat #: sc-7637 RRID:AB_627190
|
| CD63 |
Santa Cruz |
Cat #: sc-5275 RRID:AB_627877
|
| COXIV |
Abcam |
Cat #: ab14744 RRID:AB_301443
|
| DYKDDDDK Tag (D6W5B); Flag |
Cell Signaling Technology |
Cat #: 14793 RRID:AB_2572291
|
| EEA1 (C45B10) |
Cell Signaling Technology |
Cat #: 3288 RRID:AB_2096811
|
| FABP4 |
Bioss Antibodies |
Cat#: bs-4059R RRID:AB_10856161
|
| GAPDH; Glyceraldehyde 3-phosphate Dehydrogenase |
Cell Signaling Technology |
Cat #: 5174 RRID:AB_10622025
|
| H3; Histone 3 |
Cell Signaling Technology |
Cat #: 4499 RRID:AB_10544537
|
| HSP60 |
Santa Cruz |
Cat #: sc-1052 RRID:AB_631683
|
| anti-Mitochondria, human |
Abcam |
Cat #: ab92824 RRID:AB_10562769
|
| FtMT; mitochondrial ferritin |
Sigma |
SAB2700108 |
| PDH E1α; Pyruvate dehydrogenase E1α |
Abcam |
Cat #: ab110330 RRID:AB_10858459
|
| TOM20 (F-10) |
Santa Cruz |
Cat #: sc-17764 RRID:AB_628381
|
| Total OXPHOS cocktail |
Abcam |
Cat #: ab110413 RRID:AB_2629281
|
| VDAC |
Millipore Sigma |
Cat #: ab10527 RRID:AB_10806766
|
| Donkey anti-rabbit IRDye 680RD |
Li-cor |
Cat #: 926-68073 RRID:AB_10954442
|
| Donkey anti-mouse IRDye 680RD |
Li-cor |
Cat #: 926-68072 RRID:AB_10953628
|
| Goat anti-rat IRDye 680RD |
Li-cor |
Cat #: 925-68076 RRID:AB_2814913
|
| Goat anti-rabbit IRDye 800CW |
Li-cor |
Cat #: 925-32211 RRID:AB_2651127
|
| Goat anti-mouse IRDye 800CW |
Li-cor |
Cat #: 926-32210 RRID:AB_621842
|
| Goad anti-mouse HRP |
Abcam |
Cat #: ab97023 RRID:AB_10679675
|
| Chicken anti-mouse Alexa Fluor 488 |
ThermoFisher |
Cat #: A-21200 RRID:AB_2535786
|
| Donkey anti-rabbit Alexa Fluor 594 |
ThermoFisher |
Cat #: A-21207 RRID:AB_141637
|
| BV421 Goat Anti-Rabbit IgG (Flow Cytometry) |
BD Biosciences |
Cat #: 565014 RRID:AB_2716308
|
| FITC Rat Anti-Mouse Ig, κ Light Chain (Flow Cytometry) |
BD Biosciences |
Cat #: 550003 RRID:AB_393527
|
| Chemicals, peptides, and recombinant proteins |
| 3-isobutyl-1-methylxanthine (IBMX) |
Sigma |
Cat#: I7018 |
| 800W labeled streptavidin |
Li-cor |
Cat#: 926-32230 |
| ADP, Adenosine 5′-diphosphate sodium salt |
Sigma |
Cat#: A2754 |
| Aldehyde/sulfate latex beads (4μm) |
ThermoFisher |
Cat#: A37304 |
| Amicon Ultra-15 centrifugal filter units (100KD) |
Millipore |
Cat#: UFC910024 |
| Antimycin A from Streptomyces sp. |
Sigma |
Cat#: A8674 |
| BDM, 2,3-Butanedione monoxime |
Sigma |
Cat#: B0753 |
| Biotin |
Sigma |
Cat#: B4639 |
| BSA (Fatty acid free, low endotoxin) |
Sigma |
Cat#: A8806 |
| BSO (L-Buthionine-sulfoximine) |
Sigma |
Cat#: B2515 |
| L-Carnitine inner salt |
Sigma |
Cat#: C0158 |
| CellROX Deep Red Reagent |
ThermoFisher |
Cat#: C10422
|
| Chloroquine diphosphate salt (CQ) |
Sigma |
Cat#: C6628 |
| Chemically defined lipid Concentrate |
ThermoFisher |
Cat#: 11905-031 |
| Collagenase D |
Roche |
Cat#: 11088882001 |
| Collagenase 2 |
Worthington |
Cat#: LS004176
|
| Collagenase 4 |
Worthington |
Cat#: LS004188
|
| Dapi |
Sigma |
Cat#: D9542 |
| Dexamethasone |
Sigma |
Cat#: D4902 |
| Diluent C for general membrane labeling |
Sigma |
Cat#: CGLDIL |
| Dispase II |
Roche |
Cat#: 04942078001 |
| DNase I |
Qiagen |
Cat #: 79254 |
| DMEM high glucose |
ThermoFisher |
Cat#: 11965092 |
| DMEM F12 with GlutaMAX |
ThermoFisher |
Cat#: 10565-042 |
| Doxycycline chow diet |
Bio Serve |
Cat#: S4107 |
| DSPE-PEG-biotin |
Nanocs |
Cat#: PG2-BNDS-2k |
| Dynabeads |
Invitrogen |
Cat#: 110.35 |
| EZ-Link hydrazide-biotin |
ThermoFisher |
Cat#: 21339 |
| Fc Block |
BD Biosciences |
Cat#: 553142 |
| FCCP (Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone) |
Sigma |
Cat#: C2920 |
| Fetal Bovine Serum (FBS) |
Fisher Scientific |
Cat#: 03-600-511 |
| Fetal Bovine Serum (FBS) Exosome-Free |
System Biosciences |
Cat#: EXO-FBSHI-50A-1 |
| Fluorescent mounting medium |
Dako |
Cat#: S3023 |
| FluoroBright DMEM |
ThermoFisher |
Cat#: A1896701 |
| Fluorophenyl column (2.7 micron, 2.1×100 mm) |
Restek Corporation |
Cat# 9319A12 |
| Gelatin (2%) |
Sigma |
Cat#: G1393 |
| GelCode blue |
ThermoFisher |
Cat#: 24590 |
| Gentamycin |
Gibco |
Cat#: 15750-060 |
| Glucose |
Gibco |
Cat#: 15023-021 |
| GW4869 |
Sigma |
Cat#: 567715 |
| HEPES |
Gibco |
Cat#: 15630-080 |
| Heart slicer matrix |
Zinc Instruments |
Cat#: HSMA001-1 |
|
In Situ Cell Death Detection Kit |
Roche |
Cat#: 12156792910 |
| Insulin |
Sigma |
Cat#: I6634 |
| Iodixanol, 60%w/v
|
BioVision |
Cat#: M1248 |
| iScript cDNA Synthesis Kit |
BIORAD |
Cat#: 1708890 |
| Laminin |
ThermoFisher |
Cat#: 23017015 |
| ITS Liquid Media Supplement |
Sigma |
Cat#: I3146 |
| NaF |
Sigma |
Cat#: S6776 |
| Na3VO4 (Orthovanadate) |
Sigma |
Cat#: S6508 |
| NTA 488nm Fluorescence Standard Beads |
Malvern |
Cat#: NTA4095 |
| NuPAGE 4–12% Bis-Tris Gel |
ThermoFisher |
Cat#: NP0335BOX |
| L-(–)-Malic acid |
Sigma |
Cat#: M6413 |
| MDA, Malonaldehyde bis(dimethyl acetal) |
Fisher Scientific |
Cat#: AC 14861-1000 |
| M199 medium |
Sigma |
Cat#: M4530 |
| MatTek 8 well culture slides |
MatTek |
Cat#: CCS-8 |
| MitoB |
Cayman Chemical |
Cat#: 17116 |
| MitoQ |
a generous gift from Mike Murphy |
|
| Mouse diet, doxycycline (600mg/kg) chow |
Bio Serve |
Cat#: S4107 |
| Mouse diet, High fat diet (60%) |
Bio Serve |
Cat#: S5867 |
| Mouse diet, High fat diet (60%), doxycycline (600mg/kg) |
Bio Serve |
custom order |
| Oligomycin from Streptomyces diastatochromogenes
|
Sigma |
Cat#: O4876 |
| Palmitate, sodium salt |
Sigma |
Cat#: P9767 |
| Palmitate, sodium salt (alternative source) |
Santa Cruz |
Cat#: sc-215881 |
| Pantothenate |
Sigma |
Cat#: P5155 |
| Penicillin-Streptomycin (10, 000U/mL) |
ThermoFisher |
Cat#: 15140122 |
| PKH26 Red Fluorescent Cell Linker kit |
Sigma |
Cat#: PKH26GL-1KT |
| Protease inhibitor cocktail |
Millipore |
Cat#: 539137 |
| Protease XIV |
Sigma |
Cat#: P5147 |
| Protein sample loading buffer (4x) |
Li-cor |
Cat#: 928-40004 |
| Pyruvate, sodium salt |
Sigma |
Cat#: P4562 |
| QIAamp DNA micro kit |
Qiagen |
Cat#: 56304 |
| Quick Western Kit |
Li-cor |
Cat#: 926-69100 |
| Rotenone |
Sigma |
Cat#: R8875 |
| Streptavidin coated plates (Pierce) |
ThermoFisher |
Cat#: 15501 |
| Stop solution (Elisa) |
ThermoFisher |
Cat#: N600 |
| Succinate, Sodium dibasic hexahydrate |
Sigma |
Cat#: S2378 |
| SYBR Green PCR Master Mix |
Applied Biosystems |
Cat#: 4309155 |
| Syringe-driven filter (0.22 μm) |
Millipore |
Cat#: SLGP033NS |
| TMB Substrate (Elisa) |
ThermoFisher |
Cat#: N301 |
| Trans-blot Turbo Nitrocellulose Transfer pack |
BioRad |
Cat#: 1704158 |
| Trans-blot Turbo PVDF Transfer pack |
BioRad |
Cat#: 1704156 |
| Transferrin (human) |
Sigma |
Cat#: T2252 |
| Triiodothyronine (T3) |
Sigma |
Cat#: T6397 |
| Taurine |
Sigma |
Cat#: T8691 |
| Trehalose |
Sigma |
Cat#: T0167 |
| Trichloroacetic Acid |
Sigma |
Cat#: T4885 |
| Thiobarbituric Acid (TBA) |
Caymen Chemical |
Cat#: 10009199 |
| Triton-X100 |
Sigma |
Cat#: T9284 |
| TRIzol reagent |
Fisher Scientific |
Cat#: 12034977 |
| Rosiglitazone |
Sigma |
Cat#: R2408 |
|
|
|
| Critical commercial assays |
| Cardiac troponin I (CTNI) Elisa kit |
Life Diagnostics |
Cat#: CTNI-1-HSP |
| QIAamp DNA micro Kit |
Qiagen |
Cat#: 56304 |
|
|
|
|
|
|
|
|
|
| Deposited data |
| Adipo-FtMT Proteomics: MassIVE, massive.ucsd.edu; accession #: MSV000085896. |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| Experimental models: cell lines |
| SGBS cells: human adipocyte precursor. |
(Fischer-Posovszky et al., 2008) |
|
| Experimental models: organisms/strains |
| mouse: WT C57BL6/J |
Jackson Laboratory |
No. 000664 |
| mouse: B6-Tg TRE-(FtMT) Mitoferritin |
|
|
| mouse: B6-Tg adiponectinP-rtTA |
(Wang et. al., 2010) |
N/A |
| mouse: TRE-SOD2-shRNA-835 |
Jackson Laboratory |
No. 032649 |
| Mouse: TRE-mito-APP |
(An et. al., 2019) |
N/A |
|
|
|
| Oligonucleotides |
| human mtDNA, Fwd: 5’CTAGAAACCCCGAAACCAAA3’ |
|
|
| human mtDNA,Rev: 5’CCAGCTATCACCAAGCTCGT3’ |
|
|
| human mtDNA gene mitochondrially encoded tRNA leucine 1 (MT-TL1), Fwd: 5’CACCCAAGAACAGGG TTTGT3’ |
|
|
| human mtDNA gene mitochondrially encoded tRNA leucine 1 (MT-TL1), Rev: 5’TGGCCATGGGTATGTTGTTA3’ |
|
|
| Mouse β-2 microglobulin (B2M), Fwd: 5’ATGGGAAGCCGAACATACTG3’ |
|
|
| Mouse β-2 microglobulin (B2M), Rev: 5’CAGTCTCAGTGGGGGTGAA3’ |
|
|
| Human B2M nuclear DNA, Fwd: 5’TGCTGTCTCCATGTTTGATGTATCT3’ |
|
|
| Human B2M nuclear DNA, Rev: 5’TCTCTGCTCCCCACCTCTAAG T3’ |
|
|
| qPCR TRE-mitoFlag, Fwd: AGTTCAAGTGCACCGGAGAG |
|
|
| qPCR TRE-mitoFlag, Rev: GGCCAGGATATCGAAAGCGA |
|
|
| Software and algorithms |
| Excel |
Microsoft |
N/A |
| Fiji (ImageJ) |
Fiji |
https://fiji.sc/
|
| FlowJo |
FlowJo |
https://www.flowjo.com/
|
| Image J |
NIH |
https://imagej.nih.gov/ij/
|
| LabSolutions V 5.82 |
Shimadzu Scientific Instruments |
N/A |
| LabSolutions Insight V 2.0 program packages |
Shimadzu Scientific Instruments |
N/A |
| Prism |
GraphPad Software |
GraphPad Software |
| Other |
| Zeiss LSM8800 Airyscan Confocal Microscope |
Zeiss |
|
| Keyence BZ-X700 Fluorescence Microscope |
Keyence |
|
| 1200EX Transmission Electron Microscope |
JEOL |
|
| LSRFortessa SORP |
BD Bioscience |
|
| FACS Aria Fusion |
BD Bioscience |
|
| MagNA Lyser |
Roche |
|
| ZetaView |
Particle Metrix |
|
| Odyssey Infrared Imager |
Li-cor |
|
| Seahorse XFe24 Analyzer |
Agilent |
|
