KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| PE anti-mouse CD4 | BioLegend | Cat#100408; RRID:AB_312693 |
| PE/Cyanine7 anti-mouse/human CD44 | BioLegend | Cat#103030; RRID:AB_830787 |
| APC anti-mouse CD62L | BioLegend | Cat#104412; RRID:AB_313099 |
| Purified Rat Anti-Mouse IL-4 | BD Bioscience | Cat#554433; RRID:AB_395389 |
| PE-Cy7 Rat Anti-Mouse IFN-γ | BD Bioscience | Cat#557649; RRID:AB_396766 |
| PE anti-mouse IL-17A | BioLegend | Cat#506904; RRID:AB_315464 |
| APC anti-mouse IL-2 | BioLegend | Cat#503810; RRID:AB_315304 |
| Alexa Fluor® 488 anti-mouse IL-4 | BD Bioscience | Cat#557728; RRID:AB_396836 |
| PE anti-mouse IL-13 | BioLegend | Cat#159403; RRID:AB_2832569 |
| PE anti-FOXP3 Monoclonal | eBioscience | Cat#12-5773-82; RRID:AB_465936 |
| APC anti-CD25 Monoclonal Antibody | eBioscience | Cat#17-0251-82; RRID:AB_469366 |
| PE anti-STAT3 Phospho (Tyr705) Antibody | BioLegend | Cat#651004; RRID:AB_2571892 |
| PE Mouse Anti-Stat4 (pY693) | BD Bioscience | Cat#562073; RRID:AB_10895804 |
| Pacific Blue anti-human CD3 | BioLegend | Cat#317314; RRID:AB_571909 |
| PE anti-human CD4 | BioLegend | Cat#317410; RRID:AB_571955 |
| PerCP/Cyanine5.5 anti-human CD45RO | BioLegend | Cat#304222; RRID:AB_2174124 |
| PE/Cyanine7 anti-human CD45RA | BioLegend | Cat#304126; RRID:AB_10708879 |
| Alexa Fluor® 647 anti-human IFN-γ | BioLegend | Cat#502516; RRID:AB_493031 |
| PE Mouse anti-Human IL-17A | BD Bioscience | Cat#560486; RRID:AB_1645512 |
| FITC anti-human IL-2 | BioLegend | Cat#500304; RRID:AB_315091 |
| PE anti-human IL-13 | BioLegend | Cat#501903; RRID:AB_315198 |
| PE Mouse Anti-Human IL-4 | BD Bioscience | Cat#559333; RRID:AB_397230 |
| PE Mouse anti-Human FoxP3 | BD Bioscience | Cat#560852; RRID:AB_10563418 |
| APC anti-CD25 Monoclonal Antibody | eBioscience | Cat#17-0257-42; RRID:AB_11218671 |
| human FcR blocking reagent | Miltenyi Biotec | Cat#130-059-901; RRID:AB_2892112 |
| APC anti-human CD3 | BioLegend | Cat#317318; RRID:AB_1937212 |
| PerCP/Cyanine5.5 anti-human CD4 | BioLegend | Cat#317428; RRID:AB_1186122 |
| BV650 Mouse Anti-Human CD45RO | BD Bioscience | Cat#563749; RRID:AB_2744412 |
| Pacific Blue anti-human CD183 (CXCR3) | BioLegend | Cat#353724; RRID:AB_2561442 |
| BB515 Mouse Anti-Human CD196 (CCR6) | BD Bioscience | Cat#564479; RRID:AB_2738825 |
| ZEB1 (E2G6Y) XP® Rabbit mAb | Cell Signaling Technology | Cat#70512S; RRID:AB_2827862 |
| Jak2 (D2E12) XP® Rabbit mAb | Cell Signaling Technology | Cat#3230S; RRID:AB_2128522 |
| Stat3 (124H6) Mouse mAb | Cell Signaling Technology | Cat#9139S; RRID:AB_331757 |
| Phospho-Stat3 (Tyr705) (D3A7) XP® Rabbit mAb | Cell Signaling Technology | Cat#9145S; RRID:AB_2491009 |
| Phospho-Stat3 (Ser727) (D8C2Z) Rabbit mAb | Cell Signaling Technology | Cat#94994S; RRID:AB_2800239 |
| Stat4 (C46B10) Rabbit mAb | Cell Signaling Technology | Cat#2653S; RRID:AB_2255156 |
| Anti-p-Stat4 Antibody | Santa Cruz | Cat#sc-28296; RRID:AB_628294 |
| Purified Rat Anti-Mouse IFN-γ | BD Bioscience | Cat#554409; RRID:AB_398550 |
| Purified NA/LE Rat Anti-Mouse IL-2 | BD Bioscience | Cat#554375; RRID:AB_395355 |
| Pacific Blue anti-mouse CD3 | BioLegend | Cat#100214; RRID:AB_493645 |
| Bacterial and virus strains | ||
| DH5α | New England Biolabs | Cat#C2987I |
| Biological samples | ||
| Leukopak | ALLCELLS | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| RPMI 1640 Medium | GIBCO | Cat#21875034 |
| Recombinant human TGF-b1 | PeproTech | Cat#100-21 |
| Recombinant human IL-2 | PeproTech | Cat#200-02 |
| Recombinant human IL-4 | PeproTech | Cat#204-04 |
| Recombinant human IL-12 | PeproTech | Cat#200-12 |
| Recombinant human IL-1β | PeproTech | Cat#200-01B |
| Recombinant human IL-23 | PeproTech | Cat#200-23 |
| Recombinant mouse IL-12 | PeproTech | Cat#210-12 |
| Recombinant mouse IL-4 | PeproTech | Cat#214-14 |
| Recombinant mouse IL-6 | PeproTech | Cat#216-16 |
| Tamoxifen | Millipore Sigma | Cat#T5648 |
| Corn Oil | Millipore Sigma | Cat#C8267 |
| Mycobacterium tuberculosis H37Ra | Difco | Cat#DF3114-33-8 |
| MOG35–55 | Genemed Synthesis | Cat#MOG3555-P2 |
| Pertussis toxin | List Biological Laboratories | Cat#180 |
| Fedratinib | TargetMol | Cat#T1995-CUST |
| ISOLYMPH | CTL | Cat#759050 |
| CellTrace™ CFSE Cell Proliferation Kit | ThermoFisher | Cat#C34554 |
| LIVE/DEAD Fixable Violet Dead Cell Stain Kit | ThermoFisher | Cat#L34963 |
| LIVE/DEAD Fixable Aqua Dead Cell Stain Kit | ThermoFisher | Cat#L34957 |
| Critical commercial assays | ||
| Dynabeads CD4 Positive Isolation Kit | ThermoFisher | Cat#11331D |
| Dynabeads Pan Mouse IgG | ThermoFisher | Cat#11041 |
| Dynabeads Human T-Activator CD3/CD28 | ThermoFisher | Cat#11161D |
| EasySep Mouse Naive CD4+ T Cell Isolation Kit | STEMCELL | Cat#19765 |
| Dynabeads Mouse T-Activator CD3/CD28 | ThermoFisher | Cat#11452D |
| Amaxa Human T cell Nucleofector kit | Lonza | Cat# C34554 |
| RNeasy Micro kit | QIAGEN | Cat#74004 |
| QuantSeq 3′ mRNA-Seq Library Prep Kit FWD | Lexogen | Cat#015.96 |
| miRNeasy mini kit | QIAGEN | Cat#217004 |
| NEBNext Small RNA Library Prep Set for Illumina | NEB | E7330S |
| Deposited data | ||
| RNA-seq for Monocytes and CD4+ T cells of MS patients | International Multiple Sclerosis Genetics Consortium, 2019a | Dyrad: http://datadryad.org/stash/dataset/ doi:10.7272/Q6HQ3X3M |
| RNA-seq for mouse Th cells | Stubbington et al., 2015 | ArrayExpress: E-MTAB-2582 |
| RNA-seq | This paper | GEO: GSE179835 |
| single cell RNA-seq | This paper | GEO: GSE179835 |
| miRNA-seq | This paper | GEO: GSE179835 |
| Experimental models: Cell lines | ||
| Jurkat | ATCC | TIB-152 |
| Experimental models: Organisms/strains | ||
| C57BL/6 mice | Jackson | Cat#000664; RRID:IMSR_JAX:000664 |
| CD4CreErt2, C57BL/6 background | Jackson | Cat#022356; RRID:IMSR_JAX:022356 |
| CD4Cre, C57BL/6 background | Jackson | Cat#022071; RRID:IMSR_JAX:022071 |
| ZEB1fl/fl, C57BL/6 background | Dr. Susan M. Kaech | N/A |
| Oligonucleotides | ||
| siZEB1-1 | Dharmacon | Cat#L-006564-01-0005 |
| siZEB1-2 | Dhabormacon | Cat#E006564-00-0005 |
| miR-101-3p mimics | Dharmacon | Cat#C-300518-07-0002 |
| microRNA Mimic Negative control | Dharmacon | Cat#CN-001000-01-05 |
| miR-101-3p hairpin inhibitors | Dharmacon | Cat#IH-300518-08-0002 |
| microRNA hairpin inhibitor negative control | Dharmacon | Cat#IN-001005-01-05 |
| siCTL | Dharmacon | Cat#D-001910-10-05 |
| hJAK2-forward: ATGAAGTTTAAACAAGCTTGAATTCATGGGAATGGCCTGCCTTAC | IDT | N/A |
| hJAK2-reverse: CGGCCGCGCTAGCCTCGAGGGATCCTTAGCGAGATCCGGTGGAG | IDT | N/A |
| copGFP-forward: ATGAAGTTTAAACAAGCTTGAATTCGGGCAGAGCGCACATCGC | IDT | N/A |
| copGFP-reverse: CGGCCGCGCTAGCCTCGAGGGATCCTTAGCGAGATCCGGTGGAGC | IDT | N/A |
| Recombinant DNA | ||
| human JAK2 cDNA | Dharmacon | Cat#OHS6084-202638642 |
| pCDH-CMV-MCS-EF1α-copGFP | SBI | Cat#CD511B-1 |
| pmaxCloning Vector | Lonza | Cat#VDC-1040 |
| Software and algorithms | ||
| R (v3.6.0) | The R Foundation | https://www.r-project.org |
| ImageJ (Fiji) | NIH | https://imagej.nih.gov/ij/docs/guide/146-2.html; RRID: SCR_003070 |
| Flowjo | Flowjo LLC | https://www.flowjo.com/solutions/flowjo |
| STAR | GitHub | https://github.com/alexdobin/STAR |
| Samtools | MIT | https://github.com/samtools/samtools |
| DESeq2 | Bioconductor | http://bioconductor.org/packages/devel/bioc/html/DESeq2.html; RRID: SCR_015687 |
| Prism v9 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| Bowtie2 | GitHub | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |