Deoxyhypusine Synthase Promotes a Pro-Inflammatory Macrophage Phenotype

. Author manuscript; available in PMC: 2022 Sep 7.

Published in final edited form as: Cell Metab. 2021 Sep 7;33(9):1883–1893.e7. doi: 10.1016/j.cmet.2021.08.003

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
rabbit anti-ODC	Lisa Shantz, Pennsylvania State University College of Medicine	N/A
mouse anti-DHPS	Santa Cruz	Cat# sc-365077, RRID:AB_10846806
rabbit anti-eIF5A^Hyp	Mirmira laboratory	N/A
mouse anti-eIF5A	BD Pharmigen	Cat# 611977, RRID:AB_399398
rabbit anti-BiP	Cell Signaling	Cat# 3183, RRID: AB_10695864
Mouse anti-Hsp90	Enzo	Cat# SPA-830J, RRID: AB_1505637
rabbit anti-cleaved caspase-3	Cell Signaling	Cat# 9664, RRID: AB_2070042
Mouse anti-phosho-histone-H3	Millipore	Cat# 05-598, RRID: AB_309832
rabbit anti-PCNA	Santa Cruz	Cat# sc-7907, RRID: AB_2160375
rabbit anti-ERK 1/2	Santa Cruz	Cat# sc-94, RRID: AB_2140110
mouse anti-caveolin	Novus	Cat# NB100-615, RRID:AB_10003431
rabbit anti-iNOS	Novus	Cat# NBP1-33780, RRID: AB_10004114
mouse anti-GADPH	Novus	Cat# NB600-502, RRID: AB_10077682
rat anti-F4/80	Abcam	Cat# Ab6640, RRID: AB_1140040
PE anti-mouse CD206	Biolegend	Cat# 141706, RRID: AB_10895754
FITC anti-mouse F4/80	Biolegend	Cat# 123108, RRID: AB_893502
PECy7 anti-mouse CD45	Biolegend	Cat# 109829
APC Cy7 anti-mouse CD11b	Biolegend	Cat# 101225, RRID: AB_830641
APC anti-mouse iNOS	Invitrogen	Cat# 175920-82, RRID: AB_2573244
chicken anti-GFP	Aves labs	Cat# GFP-1020, RRID: AB_10000240
anti-chicken secondary antibody	Molecular probes	Cat# A-11040, RRID: AB_2534097
Anti-rabbit PE Dazzle	Invitrogen	Cat# A11036

Chemicals, Peptides, and Recombinant Proteins
RPMI Medium 1640 (1X)	Gibco	11875-093
PBS	Gibco	14190-144
HEPES Buffer	Corning	25-060-CI
Collagenase	Sigma	C2-22
Collagenase	Sigma	C7657
Penicilin Streptomycin	Thermo Fisher Scientific	15140-122
Heat inactivated FBS	Gibco	10082-147
EDTA	Fisher Scientific	BP120-500
Ammonium chloride	Fisher Scientific	A661-500
Potassium bicarbonate	Fisher Scientific	P184-500
rmM-CSF recombinant mouse	R&D Systems	416-ML
rmIFN-γ recombinant mouse	Prospec	Cyt-358-b
rmIL-4 recombinant mouse	R&D Systems	404-ML
Lipopolysaccharides from Escherichia coli 0111:B4	Sigma Aldrich	L2630
rhIFN-γ recombinant human	Prospec	CYT-206b
DAPI	Thermo Fisher Scientific	D1306
Sucrose	Fisher Scientific	BP220-212
Gc7	Biosearch Technologies	G1000
Acid acetic	Sigma Aldrich	A6283
1-Phenyl-2-thiourea	Acros organics	207250250
Formaldehyde	Fisher Scientific	04042-500
PIPES	Sigma Aldrich	P6757-500
MgSO4	Fisher Scientific	BP213-1
EGTA	Fisher Scientific	02783-100
TOPRO-3	Thermo Fisher Scientific	T3605
Urea	Sigma	U0631
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)	Sigma	H3375
Acetonitrile, HPLC grade	J.T. Baker	9829-03
Acetonitrile anhydrous	Sigma	271004
Ammonium hydroxide solution	Sigma	338818
BCA Protein Assay Kit	Thermo Scientific Pierce	A53225
DTT	Thermo Fisher Scientific	20291
Iodoacetamide	Thermo Fisher Scientific	90034
EDTA disodium salt solution 0.5M	Sigma	E7889
Formic acid	Sigma	33015
HPLC Grade Water	J.T. Baker	4218-03
Hydroxylamine Solution 50%	Sigma	467804
Lysyl Endopeptidase	Wako Chemicals	129-02541
PMSF (Phenylmethylsulfonyl fluoride)	Roche	10837091001
Reversed phase tC18 SepPak	Waters	186002319
Sequencing grade modified trypsin	Promega	V5117
Sodium chloride solution; 5M	Sigma	S5150
TMTpro 16plex reagent kit	Thermo Fisher Scientific	A44520
Tris (hydroxymethyl)aminomethane hydrochloride pH 8.0; 1M	Sigma	T2694
Trifluoroacetic acid	Sigma	91707

Commercial Resources
Normal Chow diet	Harlan Labs	2018S
Low fat diet	Research Diets	D12450B
High fat diet (60%)	Research Diets	D12492
Mouse cytokine/chemokine magnetic bead Milliplex Map Kit	Millipore	MCYTOMAG-70K-PMX
High-Capacity cDNA Reverse Transcription Kit	Applied Biosystems	4368814

Experimental Models: Organisms and strains
C57BL/6 mice	Jackson Laboratories	000664
Lyz2 promoter driven-Cre recombinase mouse	Jackson Laboratories	004781
Dhps^Loxp/Loxp mice	Raghavendra G Mirmira, deposited into Jackson Laboratories	034895
Dhps^ΔMyel mice	Raghavendra G. Mirmira	N/A
Wildtype (AB) Zebrafish	Zebrafish International Resource Center	ZL1
Tg(mpeg1:GFP) Zebrafish	Zebrafish International Resource Center	ZL9940

Experimental Models: Cell lines and Tissue
Mouse: RAW264.7	ATCC	TIB-71

Oligonucleotides
Ccl3 (mouse)	Applied Biosystems	Taqman-Assay ID Mm00441259_g1, Cat #4453320
Il1b (mouse)	Applied Biosystems	Taqman-Assay ID Mm00434228_m1, Cat 4453320

Morpholino
Dhps MO GGTTATGGATGTAAATCCGGCTTTT	Gene Tools, LLC	N/A

Deposited data
RNA Sequencing data	GEO	Accession: GSE144614
Proteomics data	Proteome Exchange	PXD026266
All other data in this manuscript	Mendeley Data	Mirmira, Raghavendra (2021), “Deoxyhypusine Synthase promotes a pro inflammatory macrophage phenotype”, Mendeley Data, V1, doi: 10.17632/kz5rwgpgwc.1 (http://dx.doi.org/10.17632/kz5rwgpgwc.1)

Software and Algorithms
Image Studio Software	LI-COR	Version 3.1.4
Prism Software	GraphPad, Inc.	Version 9.1
STAR 2.3.0	Alexander Dobin	https://github.com/alexdobin/STAR
ngsutils	Marcus Breese and Yunlong Liu	https://github.com/ngsutils/ngsutils
EdgeR package	Bioconductor	http://bioconductor.org/packages/release/bioc/html/edgeR.html
MS-GF+	Omics Group, Pacific Northwest National Lab	https://omics.pnl.gov/software/ms-gf
DAVID	Laboratory of Human Retrovirology and Immunoinformatics	https://david.ncifcrf.gov/tools.jsp
mzRefinery	Omics Group, Pacific Northwest National Lab	https://omics.pnl.gov/software/mzrefinery
MASIC	Omics Group, Pacific Northwest National Lab	https://omics.pnl.gov/software/masic
Decon2LS_V2	Omics Group, Pacific Northwest National Lab	https://omics.pnl.gov/software/decontools-decon2ls