Skip to main content
. 1999 Feb;37(2):467–470. doi: 10.1128/jcm.37.2.467-470.1999

FIG. 2.

FIG. 2

Specificity analysis of devR-based PCR assay. DNA amplifications were performed by using primers devRf and devRr, and the reaction products were electrophoresed on a 1% agarose gel, transferred to a positively charged nylon membrane, and hybridized with 32P-labeled internal oligonucleotide devR1 (5′ CCGTCCAGCGCCCACATCTTT 3′) at 55°C in a solution containing 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 20 mM sodium phosphate (pH 7.0), 10× Denhardt’s solution, 7% sodium dodecyl sulfate (SDS), and 200 μg of salmon sperm DNA/ml. The blot was washed twice at room temperature with 2× SSC–0.1% SDS and twice at 58°C for 15 min with 0.2× SSC–0.2% SDS. The ethidium bromide and hybridization profiles are shown in panels A and C and panels B and D, respectively. The amplified product of 513 bp is indicated by arrows. Lanes M, molecular weight marker. Other lanes contain the products from the following organisms: lane 1, Mycobacterium tuberculosis H37Rv; lane 2, M. tuberculosis H37Ra; lane 3, Mycobacterium bovis BCG; lane 4, Mycobacterium microti; lanes 5 to 9, clinical isolates of M. tuberculosis C1084, P8460, 779634, 8473, and C1270, respectively, obtained from the Department of Microbiology, All India Institute of Medical Sciences and Tuberculosis Research Center, Chennai, India; lane 10, Mycobacterium avium; lane 11, Mycobacterium intracellulare; lane 12, Mycobacterium scrofulaceum; lane 13, Mycobacterium xenopi; lane 14, Mycobacterium fortuitum; lane 15, Mycobacterium phlei; lane 16, Mycobacterium gordonae; lane 17, Mycobacterium vaccae; lane 18, Mycobacterium kansasii; lane 19, Mycobacterium smegmatis; lane 20, Mycobacterium gastri; lane 21, Mycobacterium chelonae; lane 22, M. leprae; lane 23, Nocardia asteroides; lane 24, Staphylococcus aureus; lane 25, Streptococcus faecalis; lane 26, Pseudomonas aeruginosa; lane 27, Aspergillus niger; lane 28, Aspergillus fumigatus; lane 29, Candida albicans; lane 30, Corynebacterium diphtheriae; lane 31, Klebsiella pneumoniae; lane 32, Streptococcus pneumoniae; lane 33, Streptomyces aureofaciens; lane 34, Escherichia coli; lane 35, M. tuberculosis DNA-positive control; lane 36, DNA-negative control.