Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Mouse monoclonal anti-FasII (1D4) |
Developmental Studies Hybridoma Bank (DSHB) | AB_528235 RRID:AB_528235 |
IF (1:50) |
| Antibody | Rabbit polyclonal anti-Wnt5a | Cell Signaling | Cat# 2392 RRID:AB_2304419 |
WB (1:1000) |
| Antibody | Rabbit polyclonal anti-GFP | Invitrogen | Cat# A-11122, RRID:AB_221569 | IF (1:500) |
| Antibody | Rabbit polyclonal anti-APP | Synaptic Systems | Cat# 127 003 RRID:AB_2056967 |
IF (1:100) WB (1:1000) |
| Antibody | Mouse monoclonal anti-rab5 | Synaptic Systems | Cat# 108 011 RRID:AB_887773 |
IF (1:100) WB (1:1000) |
| Antibody | Mouse monoclonal anti-rab11a | Santa Cruz | Cat# sc-166523, RRID:AB_2173466 | IF (1:20) |
| Antibody | Mouse monoclonal anti- Golgin-97 | Invitrogen | Cat# A-21270, RRID:AB_221447 | IF (1:100) WB (1:1000) |
| Antibody | Rat monoclonal anti-Lamp1 | Santa Cruz | Cat# sc-19992, RRID:AB_2134495 | IF (1:20) WB (1:200) |
| Antibody | Chicken polyclonal anti-GFP | Abcam | Cat# ab13970, RRID:AB_300798 | IF (1:200) |
| Antibody | Guinea pig Polyclonal antiserum anti-Ankyrin G | Synaptic Systems | Cat# 386004 RRID:AB_2725774 |
IF (1:100) |
| Antibody | Rabbit Polyclonal Anti-V5 | Millipore | Cat# AB3792 RRID:AB_91591 |
IP (1:20) WB (1:1000) |
| Antibody | Rat Monoclonal Anti-DYKDDDDK Epitope Tag | Novus | Cat# NBP1-06712 RRID:AB_1625981 |
IP (1:20) WB (1:1000) |
| Antibody | Mouse Monoclonal Anti-c-Myc | Sigma-Aldrich | Cat# M4439 RRID:AB_439694 |
IP (1:20) WB (1:1000) |
| Antibody | Goat anti-Chicken IgY (H+L), Alexa Fluor488 | Invitrogen | Cat# A-11039, RRID:AB_142924 | IF (1:500) |
| Antibody | Goat anti-Rabbit IgG (H+L), Alexa Fluor488 | Invitrogen | Cat# A-11008, RRID:AB_143165 | IF (1:500) |
| Antibody | Goat anti-Rat IgG (H+L), Alexa Fluor488 | Invitrogen | Cat# A-11006, RRID:AB_141373 | IF (1:500) |
| Antibody | Goat anti- Mouse IgG (H+L), Alexa Fluor488 | Invitrogen | Cat# A-11029, RRID:AB_138404 | IF (1:500) |
| Antibody | Goat anti-Rabbit IgG (H+L), Alexa Fluor555 | Invitrogen | Cat# A-11034, RRID:AB_2576217 | IF (1:500) |
| Antibody | Goat anti-Guinea Pig IgG (H+L), Alexa Fluor555 | Invitrogen | Cat# A-21435, RRID:AB_2535856 | IF (1:500) |
| Antibody | Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch Labs | Cat# 715-035-150, RRID:AB_2340770 | WB (1:4000) |
| Antibody | Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) | Jackson ImmunoResearch Labs | Cat# 711-035-152, RRID:AB_10015282 | WB (1:4000) |
| Antibody | Peroxidase AffiniPure Donkey Anti-Rat IgG (H+L) | Jackson ImmunoResearch Labs | Cat# 712-035-153, RRID:AB_2340639 | WB (1:4000) |
| Chemical compound, drug | Triton X-100 | Sigma | Cat#X100 | In PBS 0.1% |
| Chemical compound, drug | Trizol Reagent | Invitrogen | Cat#15596026 | |
| Chemical compound, drug | L15 medium | Gibco | 11415064 | Medium for embryo brain isolation on ice |
| Chemical compound, drug | Mounting Medium | Vector Laboratories | Cat#H-1000 | |
| Chemical compound, drug | 0.05% trypsin/EDTA | Gibco | 25300–054 | |
| Chemical compound, drug | SVF | Invitrogen | 10270106 | |
| Chemical compound, drug | DNAse | Serlabo | LS002138 | |
| Chemical compound, drug | Neurobasal medium | Gibco | 21103049 | |
| Chemical compound, drug | B27 supplement | Gibco | 17504–044 | |
| Chemical compound, drug | L-glutamax | Gibco | 35050–061 | |
| Chemical compound, drug | Wnt3a | R and D Systems | 645-WN-010 | |
| Chemical compound, drug | Wnt5a | R and D Systems | 1324-WNP-010 | |
| Chemical compound, drug | Bafilomycin A1 | invitrogen | 88899-55-2 | |
| Chemical compound, drug | LY294002 | Sigma | L9908 | |
| Chemical compound, drug | Lipofectamine 3000 | Thermofisher | Cat#L3000008 | |
| Chemical compound, drug | DMEM | Gibco | Cat#10566016 | |
| Chemical compound, drug | Penicillin-Streptomycin | Gibco | Cat#15140122 | |
| Biological sample (M. musculus) |
APP-KO mouse | A gift from Bart De Strooper’s lab | N/A | |
| Cell line (Homo-sapiens) | Hek293 | A gift from Marie-Claude Potier’s lab | N/A | |
| Sequence-based reagent | mAPP_F | This paper Ordered from IDT |
PCR primers | CATCCAGAACTGGTGCAAGCG |
| Sequence-based reagent | mAPP_R | This paper Ordered from IDT |
PCR primers | GACGGTGTGCCAGTGAAGATG |
| Sequence-based reagent | β-actin _F | This paper Ordered from IDT er |
PCR primers | TCCATCATGAAGTGTGACGT |
| Sequence-based reagent | β-actin _R | This paper Ordered from IDT r |
PCR primers | GAGCAATGATCTTGATCTTCAT |
| Transfected construct (M. musculus) | pLv-pSyn1-mAPP-Flag-IRESeGFP | ICM-institute, Virus facility | N/A | Lentiviral construct to transfect and express the mAPP |
| Transfected construct (M. musculus) | pLv-pSyn1-mAPPΔCRD-Flag-IRESeGFP | ICM-institute, Virus facility | N/A | Lentiviral construct to transfect and express the mAPP-ΔCRD |
| Transfected construct (M. musculus) | pLv-pSyn1- eGFP | ICM-institute, Virus facility | N/A | Lentiviral construct to transfect and express the GFP |
| Transfected construct (M. musculus) | pCDNA3-mApp-FLAG-IRES-eGFP | This paper | N/A | transfected construct |
| Transfected construct (M. musculus) | pCDNA3-mAPPΔCRD-FLAG-IRES-eGFP | This paper | N/A | transfected construct |
| Transfected construct (M. musculus) | pCDNA3-Wnt5a-myc | This paper | N/A | transfected construct |
| Transfected construct (M. musculus) | pCDNA-Wnt3A-V5 | This paper | N/A | transfected construct |
| Transfected construct (human) | pCDNA3-hApp-FLAG-IRES-eGFP | This paper | N/A | transfected construct |
| Transfected construct (human) | pCDNA3-hAPPΔCRD-FLAG-IRES-eGFP | This paper | N/A | transfected construct |
| Commercial assay or kit | QuantiTect Reverse Transcription Kit | Qiagen | Cat# 205311 | |
| Commercial assay or kit | LightCycler480 SYBR Green I Master | Roche | Cat# 04707516001 | |
| Commercial assay or kit | 4–12% polyacrylamide gels (SDS-PAGE) | ThermoFisher | NW04122BOX | |
| Commercial assay or kit | Protein G sepharose beads | ThermoFisher | Ref.10612D Lot.00644644 |
|
| Other | Nikon | A1-R | ||
| Other | Olympus | FV-1200 | ||
| Other | DAPI | Sigma | Cat# D9564 | 1 ug/ml |
| Software, algorithm | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | |
| Software, algorithm | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 |