Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotides used in this study
| Oligonucleotide | Sequence (5′→3′) |
|---|---|
| LF-60 | cgttaaaggctgactctcgtttga |
| LF-63 | gtcacatgaatgacgatacctc |
| LF-68 | tcatgtaggtaagactgtgtagaa |
| LF-102 | ctagcgtcattcatgtgacataaa |
| LF-106 | ctagcgtcattcatgcatcataaa |
| LF-107 | ccatcttttatgatgcatgaatga |
| LF-141 | caggaggatcacttgagcccaggag |
| LF-143 | caggaggatgcattgagcccagga |
| LF-144 | tcctgggctcaatgcatcctcctg |
| LF-145 | tggcttgcccttcacacggcgatc |
| LF-146 | ggtcaagcgattctactgcctcag |
| SRE | gatcctgatcacgtgatcgaggag |
