FIG. 4.

Potassium permanganate (KMnO₄) reactivity of the HSP82 promoter in vivo and in vitro. (A) In vivo KMnO₄ patterns before and after heat shock for both wild-type and rad25^ts mutant cells. A logarithmically growing culture was treated for 1 min with 2.2 mM KMnO₄ at either 25 or 39°C. The DNA was then purified and cleaved at the modified bases. The sites of cleavage were viewed by LMPCR with primers to display the bottom (transcribed) strand. The TATA sequence is labeled on the side of the gel, and the numbers indicate positions relative to the transcription start site. Permanganate-sensitive bands are labeled with bullets (•). (B) In vitro KMnO₄ patterns of naked DNA with and without added yeast TBP. The promoter region of the HSP82 gene was amplified from plasmid pMF13 by PCR, and 12 fmol of this fragment, containing the TATA sequence, was treated with 25 mM KMnO₄ at 25°C for 30 s in either the presence or absence of 3 pmol of yeast TBP. The primers used to amplify the fragment were UP0.1 (GAACAGGAATAAAGCTTAATCGGAT) and LARRY82 (CAGCTTGAAATTCAAAAGTTTCACT).