Skip to main content
. 2021 Aug 31;10:e65884. doi: 10.7554/eLife.65884

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus, both sexes) Kmt2d+/βGeo mice (fully backcrossed to C57BL/6J) Originally from Bay Genomics and described in PMID:2527309625273096. Kmt2d+/βGeo,Mll2Gt(RRt024)BygRRID:MGI:5829565 A previously characterized mouse model of Kabuki syndrome (type 1).
Strain, strain background (Mus musculus, females only) Kdm6a± mice (fully backcrossed to C57BL/6J, observed male lethality) Ordered from EMMA (European Mouse Mutant Archive) Kdm6a+/, Kdm6atm1d(EUCOMM)Wtsi MGI:4434460 A previously characterized mouse model of Kabuki syndrome (type 2). Transition from Kdm6atm1a(EUCOMM)Wtsi to Kdm6atm1d(EUCOMM)Wtsi performed in Bjornsson laboratory.
Strain, strain background (Mus musculus, both sexes) Crebbp±mice (fully backcrossed to C57BL/6J) Ordered from Jackson laboratory and described in PMID:10673499 Crebbp+/-Crebbptm1Dli, RRID:MGI:2175793 A previously characterized mouse model of Rubinstein-Taybi syndrome (type 1).
Sequence-based reagent βGeo F This paper PCR primers CAAATGGCGATTACCGTTGA
Sequence-based reagent βGeo R This paper PCR primers TGCCCAGTCATAGCCGAATA
Sequence-based reagent Tcrd (control) F This paper PCR primers CAAATGTTGCTTGTCTGGTG
Sequence-based reagent Tcrd (control) R This paper PCR primers GTCAGTCGAGTGCACAGTTT
Sequence-based reagent Kdm6aTm1c F This paper PCR primers AAGGCGCATAACGATACCAC
Sequence-based reagent Kdm6aTm1c, Floxed LR This paper PCR primers ACTGATGGCGAGCTCAGACC
Sequence-based reagent Tcrd (control) F- This paper PCR primers CAAATGTTGCTTGTCTGGTG
Sequence-based reagent Tcrd (control) R This paper PCR primers GTCAGTCGAGTGCACAGTTT
Sequence-based reagent CrebbpR-T F This paper PCR primers TAAGCAGCAGCATCCTTTGG
Sequence-based reagent CrebbpR-T_WT This paper PCR primers CCTGACAATGTGTCATGTGAT
Sequence-based reagent CrebbpR_T_MUT R: This paper PCR primers ATGCTCCAGACTGCCTTGGGA
Commercial assay or kit IgA ELISA kit Thermo Catalog # EMIGA
Commercial assay or kit CD19 positive selection Miltenyi 130-052-201
Commercial assay or kit Tagmentation IlluminaNextera FC-121–1030
Commercial assay or kit Digitonin Promega G9441
Commercial assay or kit DNA clean and concentration kit Zymo D4013
Commercial assay or kit Select A size purification Zymo D4080
Commercial assay or kit DNA high sensitivity Agilent 5067–4626
Commercial assay or kit Qubit dsDNA HS Thermo Q32851
Commercial assay or kit Direct-zol RNA microprep Zymo R2060
Commercial assay or kit Quant-iT RiboGreen Thermo R11490
Commercial assay or kit RNA HS Assay kit Thermo Q32852
Commercial assay or kit RNA 6000 Pico Agilent 5067–1513
Commercial assay or kit NEBNext Poly(A) mRNA isolation module New England Biolabs E7490
Commercial assay or kit NEBNext Ultra II Directional RNA Library Prep kit New England Biolabs E7760/E7765
Commercial assay or kit KAPA library Quantification kit KAPA KK4824
Software, algorithm BowTie2 PMID:22388286 RRID:SCR_016368 Default parameters
Software, algorithm Samtools PMID:19505943 RRID:SCR_002105
Software, algorithm MACS2 PMID:18798982 RRID:SCR_013291 Keep-dup = all
Software, algorithm DESeq2 PMID:25516281 RRID:SCR_015687
Software, algorithm Surrogate Variable Analysis PMID:17907809 RRID:SCR_012836
Software, algorithm Salmon PMID:28263959 V0.10RRID:SCR_017036
Other GEO submission of all data Accession GSE162181 RRID:SCR_005012