Skip to main content
. Author manuscript; available in PMC: 2021 Sep 20.
Published in final edited form as: Am J Ophthalmol. 2018 Mar 14;190:99–112. doi: 10.1016/j.ajo.2018.03.008

Table 4: Detailed analysis of EYS variants.

Summary of EYS variants identified in the patient cohort, including functional analyses.

dbSNP Chr GRCh37 Nucleotide Change Protein Variant Count in Cohort Allele Frequency M-CAP REVEL Eigen CADD DANN ClinVar Significance
-- 6 66115144 c.963_979delAAAAGGATCTTCCAGCC p.Pro321Profs 1
rs143994166 6 66112400 c.1155T>A p.Cys385Ter 2 0.0007 −0.3334 28.2 0.983 Likely pathogenic
-- 6 66063502 c.1308C>A p.Cys436Ter 1 0.000004073 −0.0979 35 0.974
rs752504462 6 66044995 c.1641_1644delTCAG p.Ser547Argfs 1 0.000004084
-- 6 66044994 c.1645G>T p.Glu549Ter 1 −0.2863 25.8 0.965
rs749103801 6 66005817 c.1961_1962insA p.Asn654Lysfs 1 0.000006599
-- 6 65596589 c.2992+1G>A 1 0.6634 23.3 0.931
rs778646190 6 65523464 c.3250A>C p.Thr1084Pro 2 0.00006855 0.04 0.18 −1.1326 0.322 Uncertain
rs373441420 6 65523270 c.3443+1G>T 3 0.00002119 0.846 23.4 0.976 Pathogenic
-- 6 65336027 c.3555C>G p.Cys1185Trp 1 0.84 0.85 0.6131 26.4 0.99
rs928803207 6 65301640 c.4120C>T p.Arg1374Ter 2 0.00001347 −0.0156 35 0.997
rs778752557 6 65301358 c.4402G>C p.Asp1468His 2 0.00008771 0.06 0.33 −0.0124 24.5 0.994 Uncertain
-- 6 65150442 c.5645-1197-c.5927+3169 1
-- 6 65098733 c.5928delG p.Arg1976Serfs 1
rs749909863 6 64940493 c.6416G>A p.Cys2139Tyr 1 0.0001 0.35 0.76 0.6828 29.5 0.997 Uncertain | Pathogenic
-- 6 64791744 c.6571+5G>A 1 0.00001486 1.3819 14.39 0.786
rs752953889 6 64776242 c.6714delT p.Ile2239Serfs 1 0.00003948 Likely pathogenic
rs758109813 6 64709008 c.6794delC p.Pro2265Glnfs 3 0.0002 Pathogenic
-- 6 64498950 c.7578+1G>A 2 0.0000133 1.0605 25.9 0.996
rs527236076 6 64472413 c.8012T>A p.Leu2671Ter 1 0.00001987 0.09 0.3156 37 0.984 Likely pathogenic
rs779983752 6 64436534 c.8111T>G p.Leu2704Ter 2 0.00004052 0.6781 47 0.987
-- 6 64431514 c.8413dupA p.Thr2805Asnfs 1
rs528919874 6 64431272 c.8648_8655delCATGCAGA p.Thr2883Lysfs 1 0.0008
rs770748359 6 64430632 c.9286_9295delGTAAATATCG p.Val3096Leufs 2 0.0002 Pathogenic
rs769824975 6 64430625 c.9299_9302delCTCA p.Thr3100Lysfs 1 0.00004015
-- 6 64430591 c.9317_9336delCCAATTTTGTTGGCAAAATT p.Thr3106Lysfs 1 0.00000672
-- 6 64430540 c.9383_9387delAATTA p.Lys3128Argfs 1

All reference sequences are NM_001142800.1 HGVS.