KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| DYKDDDDK Tag Antibody | Cell Signaling Technology | Cat#2368S; Clone# N/A; RRID:AB_2217020 |
| Mouse monoclonal ANTI-FLAG M2 antibody | Sigma-Aldrich | Cat# F3165; Clone# M2; RRID: AB_259529 |
| Phospho-Tyrosine Mouse mAb (P-Tyr-100) antibody | Cell Signaling Technology | Cat# 9411S; Clone# N/A; RRID:AB_331228 |
| IDH2 | Santa Cruz Biotechnology | Cat# sc-374476; Clone# B-6; RRID: AB_10986415 |
| IDH2 | Cell Signaling Technology | Cat# 56439S; Clone# D8E3B; RRID: AB_2799511 |
| ac-IDH2K413 | GeneTel Laboratories | Cat# AC0004; Clone# N/A; RRID: N/A |
| ACAT1 | Novus Biologicals | Cat#NB400–141; Clone# N/A; RRID: AB_10001588 |
| p-ACAT1 Y407 | Cell Signaling Technology(Fan et al., 2016) | Cat# N/A; Clone# N/A; RRID: N/A |
| p-IDH2 Y107 | Shanghai HuiOu Biotechnology Com.LTD | Cat# N/A; Clone# N/A; RRID: N/A |
| p-SIRT3 Y226 | Shanghai HuiOu Biotechnology Com.LTD | Cat# N/A; Clone# N/A; RRID: N/A |
| ACAT1 Antibody | Cell Signaling Technology | Cat# 44276; Clone# N/A; RRID: AB_2799262 |
| p-IDH1 Y42 | SHANGHAI GENOMICS,INC.(Chen et al., 2019) | Cat# N/A; Clone# N/A; RRID: N/A |
| p-IDH1 Y391 | SHANGHAI GENOMICS,INC.(Chen et al., 2019) | Cat# N/A; Clone# N/A; RRID: N/A |
| Human Isocitrate Dehydrogenase1/IDH1 Antibody | R&D SYSTEMS | Cat# MAB7049; Clone# 843219; RRID: AB_2811299 |
| Acetylated-Lysine Antibody | Cell Signaling Technology | Cat# 9441; Clone# N/A; RRID: AB_331805 |
| ACAT2 (E1L8V) Rabbit mAb | Cell Signaling Technology | Cat# 13294; Clone# E1L8V; RRID: AB_2798172 |
| ChIPAb+ Trimethyl-Histone H3 (Lys4) antibody | Millipore | Cat# 17–614; Clone# N/A; RRID: AB_1587135 |
| Di-Methyl-Histone H3 (Lys9) Antibody | Cell Signaling Technology | Cat# 9753S; Clone# N/A; RRID: AB_659848 |
| Rabbit Anti-Histone H3, trimethyl (Lys9) ChIP Grade Polyclonal Antibody, Unconjugated | Abcam | Cat# ab8898; Clone# N/A; RRID: AB_306848 |
| Histone H3 (D1H2) XP Rabbit mAb antibody | Cell Signaling Technology | Cat# 4499S; Clone# N/A; RRID: AB_10544537 |
| PDC-E2 (H-160) antibody (DLAT) | Santa Cruz Biotechnology | Cat#sc-32925; Clone# H-160; RRID:AB_2091782 |
| SirT3 (C73E3) Rabbit mAb | Cell Signaling Technology | Cat#2627S; Clone# N/A; RRID: AB_2188622 |
| SIRT4 | Abcam | Cat#ab90485; Clone# N/A; RRID: AB_2286004 |
| APC anti-human CD45 Antibody | Biolegend | Cat# 368512 Clone# Clone 2D1; RRID: AB_2566372 |
| PE anti-mouse CD45.2 Antibody | Biolegend | Cat# 109808 Clone# Clone 104; RRID: AB_313445 |
| SIRT5 | Abcam | Cat# ab13697 Clone# N/A; RRID: AB_300574 |
| 5-Hydroxymethylcytosine (5-hmC) antibody (pAb) | ACTIVE MOTIF | Cat# 39069 Clone# N/A; RRID: N/A |
| Mouse monoclonal Anti-beta-Actin antibody | Sigma-Aldrich | Cat# A1978; Clone# AC-15; RRID: AB_476692 |
| Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP | Thermo Fisher Scientific | Cat# 31430; Clone# N/A; RRID: AB_228307 |
| Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP | Thermo Fisher Scientific | Cat# 31460; Clone# N/A; RRID: AB_ 228341 |
| Bacterial and Virus Strains | ||
| BL21(DE3) Chemically Competent Cells | Sigma-Aldrich | Cat# CMC0014 |
| Biological Samples | ||
| PDX (FLT3 ITD|IDH2 R140Q) | Dana Farber | Cat#DFAM-10360-V1 |
| Patient samples | Memorial Sloan-Kettering Cancer Center, | # 55653 # 45588 # 87794 |
| Patient samples | Emory University | # UPN1284 |
| Patient samples | Ohio State University | # U-18–3562 # U-19–0875 # U-19–0877 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Myelin Basic Protein bovine | Sigma-Aldrich | Cat# M1891 |
| Coomassie Brilliant Blue R-250 Staining Solution | Bio-rad | Cat# 1610436 |
| DL-Isocitric acid trisodium salt hydrate | Sigma-Aldrich | Cat# I1252 CAS: 1637–73-6 |
| β-Nicotinamide adenine dinucleotide phosphate hydrate | Sigma-Aldrich | Cat# N5755 CAS: 53–59-8 |
| β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate | Sigma-Aldrich | Cat# N1630 CAS: 2646–71-1 |
| α-Ketoglutaric acid sodium salt | Sigma-Aldrich | Cat# K2010 CAS: 22202–68-2 |
| Diaphorase from Clostridium kluyveri | Sigma-Aldrich | Cat# D5540 CAS: 9001–18-7 |
| Resazurin sodium salt | Sigma-Aldrich | Cat# R7017 CAS: 62758–13-8 |
| Ketoglutaric Acid, Sodium Salt, α-[1-14C]-, 50µCi (1.85MBq) | PerkinElmer | Cat# NEC597050UC |
| Trichostatin A | Sigma-Aldrich | Cat# T1952 |
| Blue Sepharose CL-6B | Amersham Biosciences | Cat# 17–0830-01 |
| Nicotinamide | Sigma-Aldrich | Cat# N0636 |
| TFMB-R-2-HG | Cayman | Cat# 20461 CAS: 1445700–01-5 |
| 1-(Methoxymethyl)-3-(trifluoromethyl)benzene | Combi-Blocks | Cat# OT-0769–1g CAS: 380633–51-2 |
| Arecoline hydrobromide | Sigma-Aldrich | Cat# 10980 CAS: 300–08-3 |
| Quizartinib (AC220) | Selleckchem | Cat# S1526 CAS: 950769–58-1 |
| acetyl CoA | Sigma-Aldrich | Cat# S7008 CAS: 102029–73-2 |
| Recombinant IDH2 (R140Q) proteins | ACTIVE MOTIF | Cat# 31617 |
| FLT3 Recombinant Human Protein | Thermo Fisher | Cat# PV3182 |
| FLT3 [ITD] Recombinant Human Protein | Thermo Fisher | Cat# PV6190 |
| Recombinant Human GM-CSF Protein, CF | R&D SYSTEMS | 215GM050 |
| Adenosine 5′-triphosphate (ATP) disodium salt hydrate | Sigma-Aldrich | Cat# A7699 CAS: 34369–07-8 |
| Hygromycin B | Gibco | Cat# 10687010 CAS: 31282–04-9 |
| Puromycin dihydrochloride from Streptomyces alboniger | Sigma-Aldrich | Cat# P8833 CAS: 58–58-2 |
| ANTI-FLAG® M2 Affinity Gel | Sigma-Aldrich | Cat# A2220 |
| FLAG® Peptide | Sigma-Aldrich | Cat# F3290 |
| Protein G Sepharose® 4 Fast Flow | Sigma-Aldrich | Cat# GE17–0618-01 |
| Critical Commercial Assays | ||
| TransIT®-LT1 Transfection Reagent | Mirus | Cat# MIR 2305 |
| Wizard™ Genomic DNA Purification Kits | Promega | Cat# A1125 |
| Deposited Data | ||
| RNA-seq Data | This study | GEO: GSE173531 |
| Original western blot images have been deposited at Mendeley and are publicly available as of the date of publication: | This study | https://data.mendeley.com/datasets/wrt34nw5z9/draft?a=0c0cc371-dfd3–441d-a8f8-c6577c8e4caf |
| Experimental Models: Cell Lines | ||
| Human: HEK293T cells | ATCC | Cat# CRL-3216; RRID: CVCL_0063 |
| Human:TF-1 cells | ATCC | Cat# CRL-2003; RRID:CVCL_0559 |
| Human: EL-1 cells | ATCC | Cat# CRL-9854; RRID: N/A |
| Human: MOLM-14 | (Fan et al., 2016) | Cat# N/A; RRID: N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ | The Jackson Laboratory | Stock# 005557 RRID: IMSR_JAX:005557 |
| Oligonucleotides | ||
| shRNA targeting IDH2 sequence: 5’-TGCAAGAACTATGACGGAGAT −3’ |
BROAD Institute/Open Biosystems | N/A |
| Primers: IDH2 K48R mutation, Forward: 5’-aggatcaaggtggcgaggcccgtggtggagatg’ |
This paper | N/A |
| Primers: IDH2 K48R mutation, Reverse: 5’-catctccaccacgggcctcgccaccttgatcct-3’ |
This paper | N/A |
| Primers: IDH2 K67R mutation, Forward: 5’-atctggcagttcatcagggagaagctcatcctg-3’ |
This paper | N/A |
| Primers: IDH2 K67R mutation, Reverse: 5’- caggatgagcttctccctgatgaactgccagat −3’ |
This paper | N/A |
| Primers: IDH2 K69R mutation, Forward: 5’-cagttcatcaaggagaggctcatcctgccccac −3’ |
This paper | N/A |
| Primers: IDH2 K69R mutation, Reverse: 5’-gtggggcaggatgagcctctccttgatgaactg-3’ |
This paper | N/A |
| Primers: IDH2 K80R mutation, Forward: 5’-gtggacatccagctaaggtattttgacctcggg’ |
This paper | N/A |
| Primers: IDH2 K80R mutation, Reverse: 5’-cccgaggtcaaaataccttagctggatgtccac-3’ |
This paper | N/A |
| Primers: IDH2 K106R mutation, Forward: 5’-gcactggccacccagaggtacagtgtggctgtc-3’ |
This paper | N/A |
| Primers: IDH2 K106R mutation, Reverse: 5’-gacagccacactgtacctctgggtggccagtgc-3’ |
This paper | N/A |
| Primers: IDH2 K127R mutation, Forward: 5’-cgtgtggaagagttcaggctgaagaagatgtgg-3’ |
This paper | N/A |
| Primers: IDH2 K127R mutation, Reverse: 5’- ccacatcttcttcagcctgaactcttccacacg −3’ |
This paper | N/A |
| Primers: IDH2 K133R mutation, Forward: 5’-ctgaagaagatgtggagaagtcccaatggaact-3’ |
This paper | N/A |
| Primers: IDH2 K133R mutation, Reverse: 5’-agttccattgggacttctccacatcttcttcag-3’ |
This paper | N/A |
| Primers: IDH2 K155R mutation, Reverse: 5’- gagcccatcatctgcagaaacatcccacgccta −3’ |
This paper | N/A |
| Primers: IDH2 K155R mutation, Forward: 5’-taggcgtgggatgtttctgcagatgatgggctc-3’ |
This paper | N/A |
| Primers: IDH2 K166R mutation, Forward: 5’-gtccctggctggaccaggcccatcaccattggc-3’ |
This paper | N/A |
| Primers: IDH2 K166R mutation, Reverse: 5’- gccaatggtgatgggcctggtccagccagggac-3’ |
This paper | N/A |
| Primers: IDH2 K180R mutation, Forward: 5’-catggcgaccagtacagggccacagactttgtg’ |
This paper | N/A |
| Primers: IDH2 K180R mutation, Reverse: 5’-cacaaagtctgtggccctgtactggtcgccatg-3’ |
This paper | N/A |
| Primers: IDH2 K242R mutation, Forward: 5’-cagtatgccatccagaggaaatggccgctgtac-3’ |
This paper | N/A |
| Primers: IDH2 K242R mutation, Reverse: 5’-gtacagcggccatttcctctggatggcatactg −3’ |
This paper | N/A |
| Primers: IDH2 K256R mutation, Forward: 5’-aagaacaccatactgagagcctacgatgggcgt-3’ |
This paper | N/A |
| Primers: IDH2 K256R mutation, Reverse: 5’-acgcccatcgtaggctctcagtatggtgttctt-3’ |
This paper | N/A |
| Primers: IDH2 K263R mutation, Forward: 5’-tacgatgggcgtttcagggacatcttccaggag-3’ |
This paper | N/A |
| Primers: IDH2 K263R mutation, Reverse: 5’-ctcctggaagatgtccctgaaacgcccatcgta-3’ |
This paper | N/A |
| Primers: IDH2 K272R mutation, Forward: 5’-caggagatctttgacaggcactataagaccgac-3’ |
This paper | N/A |
| Primers: IDH2 K272R mutation, Reverse: 5’gtcggtcttatagtgcctgtcaaagatctcctg-3’ |
This paper | N/A |
| Primers: IDH2 K275R mutation, Forward: 5’-tttgacaagcactataggaccgacttcgacaag-3’ |
This paper | N/A |
| Primers: IDH2 K275R mutation, Reverse: 5’-cttgtcgaagtcggtcctatagtgcttgtcaaa-3’ |
This paper | N/A |
| Primers: IDH2 K280R mutation, Forward: 5’-aagaccgacttcgacaggaataagatctggtat-3’ |
This paper | N/A |
| Primers: IDH2 K280R mutation, Reverse: 5’-ataccagatcttattcctgtcgaagtcggtctt-3’ |
This paper | N/A |
| Primers: IDH2 K282R mutation, Forward: 5’-gacttcgacaagaataggatctggtatgagcac-3’ |
This paper | N/A |
| Primers: IDH2 K282R mutation, Reverse: 5’gtgctcataccagatcctattcttgtcgaagtc-3’ |
This paper | N/A |
| Primers: IDH2 K384R mutation, Forward: 5’-ctggagcaccgggggaggctggatgggaaccaa-3’ |
This paper | N/A |
| Primers: IDH2 K384R mutation, Reverse: 5’-ttggttcccatccagcctcccccggtgctccag-3’ |
This paper | N/A |
| Primers: IDH2 K442R mutation, Forward: 5’-ttcctcgacaccatcaggagcaacctggacaga-3’ |
This paper | N/A |
| Primers: IDH2 K442R mutation, Reverse: 5’ -tctgtccaggttgctcctgatggtgtcgaggaa-3’ |
This paper | N/A |
| Primers: IDH2 K413R mutation, Forward: 5’-agtggagccatgaccagggacctggcgggctgcatt-3’ |
This paper | N/A |
| Primers: IDH2 K413R mutation, Reverse: 5’-aatgcagcccgccaggtccctggtcatggctccact-3’ |
This paper | N/A |
| Primers: IDH2 K413Q mutation, Forward: 5’-agtggagccatgaccCaggacctggcgggctgcatt-3’ |
This paper | N/A |
| Primers: IDH2 K413Q mutation, Reverse: 5’ -aatgcagcccgccaggtcctGggtcatggctccact-3’ |
This paper | N/A |
| Primers: IDH2 Y81F mutation, Forward: 5’-atccagctaaagttttttgacctcgggct-3’ |
This paper | N/A |
| Primers: IDH2 Y81F mutation, Reverse: 5’-gtccacgtggggcaggatgagcttctcctt-3’ |
This paper | N/A |
| Primers: IDH2 Y107F mutation, Forward: 5’-ctggccacccagaagttcagtgtggctgtcaag-3’ |
This paper | N/A |
| Primers: IDH2 Y107F mutation, Reverse: 5’-tgcagagtcaatggtgacctggtcatcagtctg-3’ |
This paper | N/A |
| Primers: IDH2 Y210F mutation, Forward: 5’-atccagctaaagttttttgacctcgggct-3’ |
This paper | N/A |
| Primers: IDH2 Y210F mutation, Reverse: 5’-gacaccactgccatcttttggggtgaagac-3’ |
This paper | N/A |
| Primers: IDH2 Y238F mutation, Forward: 5’-cacagctgcttccagtttgccatccagaagaaa-3’ |
This paper | N/A |
| Primers: IDH2 Y238F mutation, Reverse: 5’-cgcaaaacctgagatggactcgtcggtgttgtacat-3’ |
This paper | N/A |
| Primers: SIRT3 Y165F mutation, Forward: 5’-ggagtggcctgttcagcaacctccagcag-3’ |
This paper | N/A |
| Primers: SIRT3 Y165F mutation, Reverse: 5’-ctgctggaggttgctgtacaggccactcc-3’ |
This paper | N/A |
| Primers: SIRT3 Y171F mutation, Forward: 5’-agcaacctccagcagttcgatctcccgtac-3’ |
This paper | N/A |
| Primers: SIRT3 Y171F mutation, Reverse: 5’ -agcaacctccagcagttcgatctcccgtac3’ |
This paper | N/A |
| Primers: SIRT3 Y175F mutation, Forward: 5’-cagtacgatctcccgttccccgaggccattttt-3’ |
This paper | N/A |
| Primers: SIRT3 Y175 mutation, Reverse: 5’-aaaaatggcctcggggaacgggagatcgtactg-3’ |
This paper | N/A |
| Primers: SIRT3 Y200F mutation, Forward: 5’-tggccaaggagctgttccctggaaactacaag-3’ |
This paper | N/A |
| Primers: SIRT3 Y200F mutation, Reverse: 5’-cttgtagtttccagggaacagctccttggcca-3’ |
This paper | N/A |
| Primers:SIRT3 Y204F mutation, Forward: 5’-ctgtaccctggaaacttcaagcccaacgtcact-3’ |
This paper | N/A |
| Primers: SIRT3 Y204F mutation, Reverse: 5’-agtgacgttgggcttgaagtttccagggtacag-3’ |
This paper | N/A |
| Primers: SIRT3 Y211F mutation, Forward: 5’-cccaacgtcactcacttctttctccggctgctt-3’ |
This paper | N/A |
| Primers:SIRT3 Y211F mutation, Reverse: 5’-aagcagccggagaaagaagtgagtgacgttggg-3’ |
This paper | N/A |
| Primers: SIRT3 Y226F mutation, Forward: 5’-ctgcttctgcggctcttcacgcagaacatcgat-3’ |
This paper | N/A |
| Primers: SIRT3 Y226F mutation, Reverse: 5’-atcgatgttctgcgtgaagagccgcagaagcag-3’ |
This paper | N/A |
| Recombinant DNA | ||
| pLVX-IDH2-FLAG | This paper | N/A |
| pLVX -IDH2-FLAG K413R | This paper | N/A |
| pLVX -IDH2-FLAG K413Q | This paper | N/A |
| pLVX-IDH2-FLAG R140Q | This paper | N/A |
| pLVX -IDH2-FLAG R140Q/K413R | This paper | N/A |
| pLVX -IDH2-FLAG R140Q/K413Q | This paper | N/A |
| pcDNA3.0-IDH2 | From Ross Levine Lab(Memorial Sloan Kettering Cancer Center) | N/A |
| pcDNA3.0-IDH2 R140Q | From Ross Levine Lab (Memorial Sloan Kettering Cancer Center) | N/A |
| pcDNA3.0-IDH2 R172K | From Ross Levine Lab (Memorial Sloan Kettering Cancer Center) | N/A |
| pET53-DEST-FLAG-SIRT3 | (Fan et al., 2016) | N/A |
| pET53-DEST-FLAG-ACAT1 | (Fan et al., 2016) | N/A |
| pET53-DEST-FLAG-ACAT1 Y407F | (Shan et al., 2014) | N/A |
| pLHCX-FLAG-ACAT1 | (Fan et al., 2016) | N/A |
| pLHCX-FLAG-ACAT1 Y407F | (Fan et al., 2016) | N/A |
| pET53-DEST-FLAG-ACAT2 | (Shan et al., 2014) | N/A |
| pET53-DEST-FLAG-DLAT | (Shan et al., 2014) | N/A |
| pET53-DEST-FLAG-CobB | (Shan et al., 2014) | N/A |
| pET53-DEST-IDH2-FLAGK48R | This paper | N/A |
| pET53-DEST -IDH2-FLAGK67R | This paper | N/A |
| pET53-DEST -IDH2-FLAGK69R | This paper | N/A |
| pET53-DEST -IDH2-FLAGK80R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K106R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K127R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K133R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K155R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K166R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K180R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K242R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K256R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K263R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K272R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K275R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K280R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K282R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K384R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K442R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K413R | This paper | N/A |
| pET53-DEST -IDH2-FLAG K413Q | This paper | N/A |
| pET53-DEST -IDH2-FLAG | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K48R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K67R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K69R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K80R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K106R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K127R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K133R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K155R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K166R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K180R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K242R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K256R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K263R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K272R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K275R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K280R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K282R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K384R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K442R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K413R | This paper | N/A |
| pET53-DEST -IDH2-FLAG R140Q/K413Q | This paper | N/A |
| pET53-DEST -IDH2-FLAGR140Q | This paper | N/A |
| pET53-DEST -IDH2-FLAG Y81F | This paper | N/A |
| pET53-DEST -IDH2-FLAG Y107F | This paper | N/A |
| pET53-DEST -IDH2-FLAG Y210F | This paper | N/A |
| pET53-DEST -IDH2-FLAG Y238F | This paper | N/A |
| pET53-DEST -SIRT3 | (Shan et al., 2014) | N/A |
| pET53-DEST -SIRT3 Y165F | This paper | N/A |
| pET53-DEST -SIRT3 Y171F | This paper | N/A |
| pET53-DEST -SIRT3 Y175F | This paper | N/A |
| pET53-DEST -SIRT3 Y200F | This paper | N/A |
| pET53-DEST -SIRT3 Y204F | This paper | N/A |
| pET53-DEST -SIRT3 Y211F | This paper | N/A |
| pET53-DEST -SIRT3 Y226F | This paper | N/A |
| Software and Algorithms | ||
| GraphPad Prism 7 software | GraphPad Software | https://www.graphpad.com/ |
| Other | ||
| N/A | ||