Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | agtr1a | Ensembl | ENSDART00000021528.7 | |
| Gene (Danio rerio) | agtr1b | Ensembl | ENSDART00000066834.5 | |
| Gene (Danio rerio) | ace1 | Ensembl | ENSDART00000114637.4 | |
| Gene (Danio rerio) | agt | Ensembl | ENSDART00000010918.5 | |
| Gene (Drosophila melanogaster) | pink1 | Ensembl | FBtr0100416 | |
| Strain, strain background (Danio rerio, AB Wild Type) |
AB WT | Zebrafish International Resource Center | ZFIN ID: ZDB- GENO-960809–7 |
|
| Strain, strain background (Danio rerio, fuguth:gal4-uas: GFP; uas-NTRmCherry) |
Tg[fuguth:gal4-uas: GFP; uas-NTRmCherry] |
doi:10.1371/journal.pone.0164645 | ||
| Strain, strain background (Danio rerio, UAS:mtPAGFP: mtDsRed2) |
Tg[UAS:mtPAGFP :mtDsRed2] |
doi: 10.1016/jj.nbd.2016.07.020 | ZFIN ID: ZDB- TGCONSTRCT-161116–1Edward Burton Lab |
|
| Strain, strain background (Danio rerio, th1:gal4; uas: NTRmCherry) |
Tg[th1:gal4; uas: NTRmCherry] |
doi: 10.1016/j.nbd.2016.07.020 | Jiulin Du lab | |
| Strain, strain background (Drosophila melanogaster) | PINK1B9 | doi: 10.1038/nature04788 | Gift from the Chung Lab. | |
| Strain, strain background (Drosophila melanogaster) | TH-Gal4 | DOI: 10.1002/neu.10185 | Gift from the Birman Lab. | |
| Strain, strain background (Drosophila melanogaster) | UAS-mito-GFP | doi: 10.1091/mbc.e05-06-0526 | Gift from the Saxton Lab. | |
| Genetic reagent (Morpholino Oligonucleotide) | agtr1a | Gene Tools LLC | agtr1a_MO | 0.5 mM(5'-GACGTTGTCCATTTTGGAGATTTGT-3') |
| Genetic reagent (Morpholino Oligonucleotide) | agtr1b | Gene Tools LLC | agtr1b_MO | 0.5 mM(5'-TCATTGCTGATGTTTGGTTCTCCAT-3') |
| Genetic reagent (PCR Master mix) | GoTaq Green Master Mix | Promega | M7122 | |
| Sequence-based reagent | Renin Angiotensin Pathway Primers | This Paper | PCR primers | Refer to Supplementary file 1 |
| Sequence-based reagent | Nuclear DNA_F | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-AGAGCGCGATTGCTGGATTCAC-3’ |
| Sequence-based reagent | Nuclear DNA_R | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-GTCCTTGCAGGTTGGCAAATGG-3’ |
| Sequence-based reagent | Mitochondria DNA_F | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-TTAAAGCCCCGAATCCAGGTGAGC-3’ |
| Sequence-based reagent | Mitochondria DNA_R | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’- GAGATGTTCTCGGGTGTGGGATGG –3’ |
| Sequence-based reagent | sgRNA primers for agtr1 | This Paper | PCR primers | Refer to Figure 3—figure supplement 1 |
| Recombinant DNA reagent | agtr1a_1b sgRNA plasmid |
This Paper | Agtr1a and agtr1b sgRNA cloned into addgene: 74,009 | |
| Recombinant DNA reagent | Agtr1a_1b sgRNA scrambled |
This Paper | Agtr1a and agtr1b scrambled sgRNA cloned into addgene: 74,009 | |
| Peptide, recombinant protein | Cas9-NLS protein | UC Berkeley | https://qb3.berkeley.edu/facility/qb3-macrolab/ | |
| Antibody | anti-AGTR1 (Rabbit polyclonal) | Proteintech | 25343–1-AP | WB(1:500)IF(1:500) |
| Antibody | anti-5HT (Rabbit polyclonal) | Immunostar | cat#20,080 | IF(1:1000) |
| Antibody | anti-TH (Mouse monoclonal) | Immunostar | cat#22,941 | IF(1:500) |
| Antibody | Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody | Thermofisher | Alexa Fluor 488 (cat# A-11001) |
IF(1:500) |
| Antibody | Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, | Thermofisher | Alexa Fluor 568 (cat# A-11036) |
IF(1:1000) |
| Antibody | chicken anti-GFP | Abcam | ab92456 | IF(1:500) |
| Antibody | rabbit anti-TH | Pel-Freez | P41301 | IF(1:1000) |
| Antibody | Goat Anti-Rabbit IgG H&L Horseradish Peroxidase conjugated antibody | Abcam | ab6721 | WB(1:1000) |
| Antibody | Rabbit Anti-Mouse IgG H&L Horseradish Peroxidase conjugated antibody | Abcam | ab6728 | WB(1:1000) |
| Commercial assay or kit | Long-Range PCR Kit | QIAGEN | cat# 206,402 | |
| Commercial assay or kit | QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina | Lexogen | cat# 015 | |
| Commercial assay or kit | QIAprep Gel Extraction Kit | Qiagen | cat# 28,704 | |
| Commercial assay or kit | Mini-PROTEAN TGX Gels | Bio-Rad | cat# 4561083 | |
| Commercial assay or kit | Trans-Blot Turbo Transfer System | Bio-Rad | cat# 1704150 | |
| Chemical compound, drug | Bioactive Compound Library | SelleckChem; curated set from UCSF Small Molecular Discovery Center | cat# L1700 | 10 µM Screening concentration |
| Chemical compound, drug | Olmesartan | Sigma-Aldrich | cat#144689-63-4 | |
| Chemical compound, drug | Aliskiren | Sigma-Aldrich | cat# 62571-86-2 | |
| Chemical compound, drug | Captopril | Sigma-Aldrich | Cat# 173334-58-2 | |
| Chemical compound, drug | Metronidazole | Selleck Chemicals | cat# S1907 | |
| Chemical compound, drug | N-acetylcysteine | Selleck Chemicals | Cat# S1623 | |
| Chemical compound, drug | Conduritol B Epoxide | Sigma Aldrich | Cat#6090-95-5 | |
| Chemical compound, drug | MPP+ | Millipore Sigma | CAS 36913-39-0 | |
| Chemical compound, drug | 1 % low melting point agarose | Sigma Aldrich | Cat#39346-81-1 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | 1.5.0 |
| Software, algorithm | Prism 7 | GraphPad | RRID:SCR_002798 | Version 7.03 |
| Software, algorithm | Matlab | Mathworks | RRID:SCR_001622 | Version R2018 |
| Software, algorithm | CellProfiler | The Broad Institute of Harvard and MIT |
RRID:SCR_007358 | Version 3.1.8 |
| Software, algorithm | R DESeq2 package | Bioconductor | RRID:SCR_015687 | Version 4.0.1 |
| Software, algorithm | R MatchIt package | https://github.com/kosukeimai/MatchIt, Ho et al., 2011 | Version 4.2.0 | |
| Software, algorithm | InCell Analyzer | GE Life Sciences | RRID:SCR_015790 | Version 1.9 |
| Software, algorithm | Ethovision XT | Noldus | RRID:SCR_000441 | |
| Software, algorithm | IMARIS | Bitplane | RRID:SCR_007370 | Version 8.4 |
| Software, algorithm | Synthego ICE software | Synthego | https://ice.synthego.com/#/ | version 2.0 |
| Software, algorithm | SnapGene Viewer | SnapGene | RRID:SCR_015053 |