Table 2.

Array patterns of six B-other cases with a solitary trisomy 21. Three of the four investigated cases had an IKZF1 N159Y mutation and the associated distinct expression pattern. The mutation was validated with PCR and the following primers: IKZF1 intron5-F1: AAGGAGCTGGCAGGTTTAGTC and IKZF1 intron6-R2: GGTTAGCCAGCAAGGACACA.

Patient	IKZF1 N159Y	RNA seq Profile	Array Pattern
1	no	no	47, XY, del(9) (p13.2)/PAX5,+ 21
2	yes	yes	47, XY, del(2)(p12p11.2),del(16)(p11.2),+ 21
3	Not analyzed		47, XX, del(3)(q25.31q25.32),del(3)(q25.32q26.1),del(3)(q26.1),del(3)(q26.32), del(3)(q26.32q26.33),chromothripsis(4)(q22.1q34.1),del(5)(q21.3q22.2),del(5)(q35.1),del(5)(q35.1),del(5)(q35.1q35.2),del(5)(q35.3),+ 21
4	yes	yes	47, XX, dup(X)(p22.33p11.22),dup(7)(q11.21q36.3),del(17)(q25.3),+21
5	yes	yes	47, XY,+21
6	Not analyzed		50, X,i(X)(p22.33p11.1)x3,der(X)(q),del(9)(p13.2)/PAX5,+ 21