Table 2. Primer details for Sanger sequencing the alpha-thalassaemia deletion region in HBA1 and HBA2.

Name	Dir	Genome Position	Gene	Genome Position	Genome Position	Primer Sequence (5'-3')
A2/3.7-F	FWD	16:221882-221901	5' to HBA2			CCCCTCGCCAAGTCCACCC
HBA1_specific_F	FWD			16:225771-225792	HBA1	CTCCAGCCGGTTCCAGCTATTG
HBA-5' SEQ REV	REV	16:222930-222950	HBA2	16:226734-226754	HBA1	GGCCTTGACGTTGGTCTTGTC
HBA-3' SEQ FWD	FWD	16:223310-223332	HBA2	16:227114-227136	HBA1	GGACCCGGTCAACTTCAAGGTGA
A2-R	REV	16:223666-223684	3' to HBA2			AAAGCACTCTAGGGTCCAGCG
3.7-R	REV			16:227698-227718	3' to HBA1	CCCCTCGCCAAGTCCACCC

α-thalassaemia PCR was undertaken using the standard protocol as described ¹⁹. PCR products were then sequenced using the primers above (see methods).

A2/3.7-F, A2-R and 3.7-R are primers used in the standard PCR assay for α ^-3.7-thalassaemia deletion.

HBA-5' SEQ REV and HBA-3' SEQ FWD were designed internal to the products to allow more coverage. All primer locations are identified in Figure 2