KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Ultra-LEAF Purified Anti-human CD3 Antibody | Biolegend | Cat#317326, RRID:AB_11150592 |
| Ultra-LEAF Purified Anti-human CD28 Antibody | Biolegend | Cat#302934, RRID:AB_11148949 |
| APC/Cyanine 7 anti-human CD14 antibody | Biolegend | Cat#301820, RRID:AB_493695 |
| APC/Cyanine 7 anti-human CD3 antibody | Biolegend | Cat#300318, RRID:AB_314054 |
| APC anti-human CD4 antibody | Biolegend | Cat#317416, RRID:AB_571945 |
| HIV-1 core antigen-RD-1 antibody | Beckman Coulter | Cat#6604667, RRID:AB_1575989 |
| Brilliant Violet™ 421 anti-human CD107a (LAMP-1) antibody | Biolegend | Cat#328626, RRID:AB_11203537 |
| PerCP/Cyanine5.5 anti-human CD3 antibody | Biolegend | Cat#300328, RRID:AB_1575008 |
| APC anti-human CD8 antibody | Biolegend | Cat#344722, RRID:AB_2075388 |
| Alexa Fluor® 700 anti-human IFN-gamma antibody | Biolegend | Cat#502520, RRID:AB_528921 |
| Alexa Fluor® 488 anti-human CD107a (LAMP-1) antibody | Biolegend | Cat#328610, RRID:AB_1227504 |
| Brilliant Violet™ 650 anti-human CD56 (NCAM) antibody | Biolegend | Cat#362532, RRID:AB_2562602 |
| BD Horizon BUV395 Mouse Anti-Human CD16 | BD Biosciences | Cat#563785, RRID:AB_2744293 |
| Brilliant Violet™ 650 anti-human CD3 antibody | Biolegend | Cat#317324, RRID:AB_2563352 |
| BUV395 Mouse Anti-Human CD8 antibody | BD Biosciences | Cat#563795, RRID:AB_2722501 |
| Brilliant Violet 711™ anti-human TNF-alpha antibody | Biolegend | Cat#502940, RRID:AB_2563885 |
| Brilliant Violet 510™ anti-human IFN-gamma antibody | Biolegend | Cat#502544, RRID:AB_2563883 |
| Normal Human IgG Control Antibody | R&D Systems | Cat#1-001-A, RRID:AB_907192 |
| Anti-HIV- gp120 Monoclonal (VRC01) | NIH AIDS Reagent Program | Cat#12033 |
| Anti-HIV- gp120 Monoclonal (3BNC117) | NIH AIDS Reagent Program | Cat#12474 |
| Anti-HIV- gp120 Monoclonal (N6) | NIH AIDS Reagent Program | Cat#12968 |
| Anti-HIV- gp120 Monoclonal (10-1074) | NIH AIDS Reagent Program | Cat#12477 |
| Anti-HIV- gp120 Monoclonal (PGT121) | NIH AIDS Reagent Program | Cat#12343 |
| Anti-HIV Envelope Monoclonal 3BNC117 (for ADCC assays) | This paper | NA |
| Anti-HIV Envelope Monoclonal PGT121 (for ADCC assays) | This paper | NA |
| Alexa Fluor® 700 anti-human CD3 antibody | Biolegend | Cat#300324, RRID:AB_493739 |
| Alexa Fluor® 700 anti-human CD14 antibody | Biolegend | Cat#301822, RRID:AB_493747 |
| Brilliant Violet 510™ anti-human CD4 antibody | Biolegend | Cat#317444, RRID:AB_2561866 |
| Alexa Fluor® 647 anti-human IgG Fc antibody | Biolegend | Cat#409320, RRID:AB_2563330 |
| Brilliant Violet 421™ anti-human CD33 antibody | Biolegend | Cat#366622, RRID:AB_2716148 |
| HIV-1 core antigen-FITC antibody | Beckman Coulter | Cat#6604665, RRID:AB_1575987 |
| EEA1 (C45B10) Rabbit mAb antibody | Cell Signaling Technologies | Cat#3288S, RRID:AB_2096811 |
| LAMP1 (D2D11) XP Rabbit Antibody | Cell Signaling Technologies | Cat#9091S, RRID:AB_2687579 |
| Anti-Siglec-1 (CD169) Antibody, clone 5F1.1 | Sigma-Aldrich | Cat#MABT328 |
| Alexa Fluor 488-AffiniPure Donkey Anti-Rabbit IgG 9H+L) antibody | Jackson ImmunoResearch | Cat#711-545-152, RRID:AB_2313584 |
| Bacterial and Virus Strains | ||
| HIV 89.6 Proviral DNA | NIH AIDS Reagent Program | Cat#3552 |
| HIV ADA Virus | NIH AIDS Reagent Program | Cat#416 |
| Biological Samples | ||
| Human Blood Products (Buffy Coats) | Massachusetts General Hospital Blood Bank | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Recombinant Human GM-CSF | Biolegend | Cat#572904 |
| Recombinant Human M-CSF | Biolegend | Cat#574806 |
| Recombinant IL-2 | R&D Systems | Cat#202-IL-500 |
| PHA-M | Sigma-Aldrich | Cat#L8902-5MG |
| 25kDa polyethylenimine | Polysciences | Cat#23966-1 |
| Recombinant IL-15 | Biolegend | Cat#570304 |
| Recombinant Human CD19-Fc Chimera Protein, CF | R&D Systems | Cat#9269-CD-050 |
| Recombinant HIV-JRCSF gp140 Trimer-Foldon | This paper | NA |
| ELISA Coating Buffer | Biolegend | Cat#421701 |
| Pierce 16% Formaldehyde, Methanol-Free | ThermoFisher | Cat#28906 |
| Triton X-100 | Sigma-Aldrich | Cat#234729 |
| Bovine Serum Albumin | Sigma-Aldrich | Cat#A9418 |
| Hoescht 3342 trihydrochloride | ThermoFisher | Cat#H3570 |
| Critical Commercial Assays | ||
| EasySep Human CD14 Positive Selection Kit II | Stemcell | Cat#17858 |
| EasySep Human CD4+ T Cell Isolation Kit | Stemcell | Cat#17952 |
| PEG-It Virus Precipitation Solution | Systems Biosciences | Cat#LV825A-1 |
| Human TruStain FcX | Biolegend | Cat#422302, RRID:AB_2818986 |
| LIVE/DEAD Fixable Blue Dead Cell Stain Kit | ThermoFisher | Cat#L34962 |
| BD CytoFix/CytoPerm | BD Biosciences | Cat#554714 |
| EasySep Human NK Cell Isolation Kit | Stemcell | Cat#17955 |
| EasySep Human CD8+ T cell Isolation Kit | Stemcell | Cat#17953 |
| CellTrace Violet Proliferation Kit | ThermoFisher | Cat#C34557 |
| Lipofectamine 3000 | ThermoFisher | Cat#L3000015 |
| EasySep Human T Cell Isolation Kit | Stemcell | Cat#17951 |
| T Cell Activation/Expansion Kit | Miltenyi Biotech | Cat#130-091-441 |
| CTS™ OpTmizer™ T Cell Expansion SFM | ThermoFisher | Cat#A1048501 |
| GolgiPlug | BD Biosciences | Cat#555029 |
| GolgiStop | BD Biosciences | Cat#554724 |
| ELISA Max Standard Set Human IFN-g | Biolegend | Cat#430101 |
| Zenon Alexa Fluor 647 Human IgG Labeling Kit | ThermoFisher | Cat#Z25408, RRID:AB_2736598 |
| LIVE/DEAD Fixable Near-IR | ThermoFisher | Cat#L34976 |
| Image-iT FX Signal Enhancer ReadyProbes Reagent | ThermoFisher | Cat#R37107 |
| Zenon Alexa Fluor 488 Mouse IgG1 Labeling Kit | ThermoFisher | Cat#Z25002, RRID:AB_2736914 |
| ProLong Gold Antifade Mountant | ThermoFisher | Cat#P36934 |
| Deposited Data | ||
| Experimental Models: Cell Lines | ||
| HEK293T/17 Cells | ATCC | Cat#CRL-11268 |
| Experimental Models: Organisms/Strains | ||
| Oligonucleotides | ||
| Recombinant DNA | ||
| CD19 and HIV CAR T Cell Constructs | This paper | NA |
| Software and Algorithms | ||
| FlowJo 10.6.0 | FlowJo LLC | https://www.flowjo.com |
| Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Zen 2009 | ZEISS | https://www.zeiss.com/microscopy/us/products/microscope-software/zen.html |
| IDEAS 6.2 | Amnis, EMD Millipore, Luminex Corp | https://www.luminexcorp.com/imaging-flow-cytometry/ |
| Other | ||
| Certified FBS | ThermoFisher | Cat#16000044 |
| 24-well low-attachment plates | Sigma-Aldrich | Cat#CLS3473 |
| 6-well low-attachment plates | Sigma-Aldrich | Cat#CLS3471 |
| 24-well non-treated TC plates | Sigma-Aldrich | Cat#CLS3738 |
| 0.45um syringe filters | Millipore | Cat#SLHV033RS |
| Cell Dissociation Buffer | ThermoFisher | Cat#13151014 |
| Nunc MaxiSorp flat-bottom | Sigma-Aldrich | Cat#M9410-1CS |
| 96 well round bottom low attachment plates | Sigma-Aldrich | Cat#CLS7007 |
| DMEM with high glucose and pyruvate | ThermoFisher | Cat#1995065 |
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This paper | N/A |
| Bacterial and Virus Strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al., 2011 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al., 2016) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC | ATCC 700294 |
| Biological Samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children's Oncology Group Cell Culture and Xenograft Repository | http://cogcell.org/ |
| Chemicals, Peptides, and Recombinant Proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350-13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433-59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 124-87-8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14-486 |
| GST-BMAL1 | Novus | Cat#H00000406-P01 |
| Critical Commercial Assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | Perkin-Elmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202-1012 |
| Deposited Data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference | This paper; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This paper; and Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental Models: Cell Lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental Models: Organisms/Strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and Nuesslein-Volhard, 2000 | ZFIN: ZDB-GENO-060207-1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al., 2012 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This paper | N/A |
| Primers for XX, see Table SX | This paper | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This paper | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT | Gene Tools | ZFIN: ZDB-MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA | This paper | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This paper | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl0130415 |
| AAV2/1-hsyn-GCaMP6- WPRE | Chen et al., 2013 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al., 2009 | Addgene Plasmid #21339 |
| Software and Algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This paper; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal. | This paper | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This paper | https://github.com/chrisamiller/aml31SuppSite |