TABLE 2.
Plasmids used in this study
| Plasmid | Characteristicsa | Reference |
|---|---|---|
| YEp351 | LEU2 2μm | 20 |
| YEp351-BNI1 | BNI1 LEU2 2μm; made by inserting the 6.5-kb BamHI-SmaI fragment from pBS-BNI1 into the corresponding sites of YEp351 | 29 |
| YEp351-BNI1-ADE3 | BNI1 ADE3 LEU2 2μm; made by inserting the 5.4-kb SmaI-SalI (filled-in) ADE3 fragment (a gift from S. Nomoto) into the SmaI site of YEp351-BNI1 | |
| pRS315 | LEU2 CEN6 | 54 |
| pRS316 | URA3 CEN6 | 54 |
| YCp50-PAC1 | PAC1 URA3 CEN6; isolated from a genomic library in YCp50 as a clone containing a 9.6-kb genomic DNA fragment of PAC1 | 41 |
| YCp50-NIP100 | NIP100 URA3 CEN6; isolated from a genomic library in YCp50 as a clone containing a 14-kb genomic DNA fragment of NIP100 | 41 |
| pRS316-BNI1 | BNI1 URA3 CEN6; made by inserting the 6.5-kb BamHI-SmaI fragment from pBS-BNI1 into the corresponding sites of pRS316 | 29 |
| pRS316-PAC1 | PAC1 URA3 CEN6; made by inserting the 3.1-kb BamHI-EcoRV fragment from YCp50-PAC1 into the BamHI-SmaI sites of pRS316 | |
| pRS316-NIP100 | NIP100 URA3 CEN6; made by inserting the 4.2-kb EcoRI-KpnI fragment from YCp50-NIP100 into the corresponding sites of pRS316 | |
| pRS314-GAL1-myc | TRP1 CEN6 | 13 |
| pRS314-GAL1-myc-BNI1 | TRP1 CEN6 GAL1-myc-BNI1 | 13 |
| pRS315-GAL1 | LEU2 CEN6; made by inserting the 0.74-kb ScaI-HindIII fragment, containing the GAL1 promoter, a multicloning site, and the TDH1 terminator, into the SpeI (filled-in)-HindIII sites of pRS315 | 13 |
| pRS315-GAL1-HA | LEU2 CEN6; made by inserting the synthetic oligonucleotide encoding two copies of the HA epitope, YPYDVPDYA, which is derived from the influenza virus hemagglutinin (HA) protein, into the EcoRI-KpnI sites in the multicloning site of pRS315-GAL1 | |
| pRS315-GAL1-HA-BNI1 | LEU2 CEN6 GAL1-HA-BNI1; made by inserting the 5.9-kb BamHI-SmaI fragment from pRS314-GAL1-myc-BNI1 containing the BNI1 open reading frame into the corresponding sites of the multicloning site of pRS315-GAL1-HA, to place BNI1 downstream of the two HA epitopes | 29 |
| pRS314-PBNI1-myc | TRP1 CEN6; made by inserting the 0.62-kb PCR fragment upstream of the BNI1 open reading frame into the EcoRI-SacI sites of pRS314-GAL1-myc to replace the GAL1 promoter with the BNI1 promoter; the 0.62-kb BNI1 promoter region was amplified by PCR with upstream primer 1 (5′-GGCCGAGCTCAGTTGGTATGGATAGAGCCAGAATGTAAAACAAGGTGGCA) and downstream primer 2 (5′-GGCCGAATTCTTCCTTTCCTTCTCTTCTTTTCTTGCTTCTCG) | |
| pRS314-PBNI1-myc-BNI1 | TRP1 CEN6 PBNI1-myc-BNI1; made by inserting the 5.9-kb BamHI-SmaI fragment from pRS314-GAL1-myc-BNI1 containing the BNI1 open reading frame into the corresponding sites of the multicloning site of pRS314-PBNI1-myc, to place BNI1 downstream of the three myc epitopes | 13 |
| pRS314-PBNI1-myc-BNI1 (490–1954) | TRP1 CEN6 PBNI1-myc-BNI1 (490–1954); made by inserting the 4.4-kb BamHI-SmaI fragment from pRS314-GAL1-myc-BNI1 (490–1954) into the corresponding sites of the multicloning site of pRS314-PBNI1-myc, to place BNI1 (490–1954) downstream of the three myc epitopes | 13 |
| pRS314-PBNI1-myc-BNI1′-1 | TRP1 CEN6 PBNI1-myc-BNI1 (Δ826–987); made by inserting the 2.5-kb BamHI site-bounded PCR fragment encoding amino acids 1 to 825 of Bni1p and the 2.9-kb BamHI-SmaI site-bounded PCR fragment encoding amino acids 988 to 1954 of Bni1p into the BamHI-SmaI sites of pRS314-PBNI1-myc, to place BNI1 (Δ826–987) downstream of the three myc epitopes; the 2.5-kb DNA fragment was amplified by PCR with upstream primer 3 (5′-TATAGGATCCAGTTGGTATGGATAGAGCCAGAATGTAAAACAAGGTGGCA) and downstream primer 4 (5′-GGCCGGATCCCGAGTTCATACCTCTGGTGCCTTC); the 2.9-kb DNA fragment was amplified by PCR with upstream primer 5 (5′-GGCCGGATCCGACGAGATTATGGACAGTCCAAAG) and downstream primer 6 (5′-CTCTCCCGGGCTAGTGCTTGTTTGGATGTTTGTTTTGGTATTACTGTTGT) | |
| pRS314-PBNI1-myc-BNI1′-2 | TRP1 CEN6 PBNI1-myc-BNI1 (Δ1239–1328); made by inserting the 3.7-kb BamHI site-bounded PCR fragment encoding amino acids 1 to 1238 of Bni1p and the 1.9-kb BamHI-SmaI site-bounded PCR fragment encoding amino acids 1329 to 1954 of Bni1p into the BamHI-SmaI sites of pRS314-PBNI1-myc, to place BNI1 (Δ1239–1328) downstream of the three myc epitopes; the 3.7-kb DNA fragment was amplified by PCR with upstream primer 3 and downstream primer 7 (5′-GGCCGGATCCCTGTGAGGAGAGTACAGATGATTG); the 1.9-kb DNA fragment was amplified by PCR with upstream primer 8 (5′-GGCCGGATCCGCATCGCAAATCAAATCAGCTGTAAC) and the downstream primer 6 | |
| pRS314-PBNI1-myc-BNI1′-3 | TRP1 CEN6 PBNI1-myc-BNI1 (1–1750); made by inserting the 5.3-kb BamHI-SacII (filled-in) fragment from pRS314-GAL1-myc-BNI1 containing the BNI1 open reading frame into the BamHI-SmaI sites of the multicloning site of pRS314-PBNI1-myc, to place BNI1 (1–1750) downstream of the three myc epitopes | 13 |
| pBS-PAC1 | PAC1; made by inserting the 3.1-kb BamHI-EcoRV fragment from YCp50-PAC1 into the corresponding sites of pBluescript KS(+) | |
| pUC19-NIP100 | NIP100; made by inserting the 4.2-kb EcoRI-KpnI fragment from pRS316-NIP100 into the corresponding sites of pUC19 | |
| pBS-pac1::URA3 | A derivative of pBS-PAC1; made by replacing the 0.85-kb SphI-HpaI internal fragment of PAC1 corresponding to amino acids 38 to 321 with the 1.2-kb URA3 fragment | |
| pUC19-nip100::URA3 | A derivative of pUC19-NIP100; made by replacing the 4.4-kb EcoRV-SacI internal fragment of NIP100 corresponding to amino acids 67 to 731 with the 1.2-kb URA3 fragment | |
| pUC19-ARP1 | ARP1; made by inserting the 2.2-kb BamHI-SalI site-bounded coding region plus the fragment including the ARP1 0.5-kb upstream and 0.5-kb downstream noncoding regions into the corresponding sites of pUC19; the 2.2-kb DNA fragment was amplified by PCR with upstream primer 9 (5′-GGCCGGATCCCATAATACAGTATTTATTGATCAACG) and downstream primer 10 (5′-GGCCGTCGACTCTGAAAGGTATGTCTTCCTATTAGAC) | |
| pUC19-arp1::URA3 | A derivative of pUC19-ARP1; made by replacing the 0.97-kb ClaI-StyI internal fragment of ARP1 corresponding to amino acids 1 to 306 with the 1.2-kb URA3 fragment | |
| pUC19-CIN8 | CIN8; made by inserting the 4.1-kb BamHI-SalI site-bounded coding region plus the fragment including the CIN8 0.5-kb upstream and 0.5-kb downstream noncoding regions into the corresponding sites of pUC19; the 4.1-kb DNA fragment was amplified by PCR with upstream primer 11 (5′-GGCCGGATCCATCTGGTTTCAAGCAAGAATTGAAC) and downstream primer 12 (5′-GGCCGTCGACAAGACCATCAAAGGTTTCATTTG) | |
| pUC19-cin8::URA3 | A derivative of pUC19-CIN8; made by replacing the 2.57-kb MunI internal fragment of CIN8 corresponding to amino acids 158 to 1016 with the 1.2-kb URA3 fragment |
a
Underlined sequences are portions of BNI1, ARP1, or CIN8.