Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C57BL/6 J | The Jackson Laboratory | #000664 | |
| Strain, strain background (Mus musculus) | Gja1M213L/M213L | Xiao et al., 2020 (DOI: 10.1172/JCI134682) | ||
| Strain, strain background (AAV9) | AAV9-GST-GFP | Welgen Inc Basheer et al., 2018 (DOI: 10.1172/jci.insight.121900) | ||
| Strain, strain background (AAV9) | AAV9-GJA1-20k-GFP | Welgen Inc Basheer et al., 2018 (DOI: 10.1172/jci.insight.121900) | ||
| Strain, strain background (Aenovirus) | GJA1-20k-V5 | the CURE Vector Core Facility at University California, Los Angeles Basheer et al., 2017 (DOI: 10.1161/CIRCRESAHA.117.311955) |
||
| Strain, strain background (Aenovirus) | GFP-V5 | the CURE Vector Core Facility at University California, Los Angeles Basheer et al., 2017 (DOI: 10.1161/CIRCRESAHA.117.311955) | ||
| Strain, strain background (E. coli) | LOBSTR E. coli Expression Strain | kerafast Andersen et al., 2013; Figure 4—figure supplement 1—source data 1 (DOI: 10.1002/prot.24364) |
EC1001 | |
| Cell line (Homo-sapiens) | HEK293FT | Thermo Fisher Scientific | R70007 | |
| Transfected construct (human) | siRNA to Gja1 | Thermo Fisher Scientific | ID HSS178257 | |
| Transfected construct (human) | siRNA to DRP1 | Thermo Fisher Scientific | ID 19561 | |
| Transfected construct (human) | siRNA to Dynamin 2 | Thermo Fisher Scientific | ID s4212 | |
| Antibody | anti-Cx43-CT (Rabbit polyclonal) | Sigma-Aldrich | C6219 | WB (1:2000) |
| Antibody | anti-DRP1 (Mouse monoclonal) | Abcam | Ab56788 | WB (1:500) ICC (1:250) |
| Antibody | anti-phospho-DRP1 at S616 (Rabbit monoclonal) | Cell Signaling Technology | 4,494 S | WB (1:1000) |
| Antibody | anti-phospho-DRP1 at S616 (Rabbit polyclonal) | Cell Signaling Technology | 4,867 S | WB (1:1000) |
| Antibody | anti-MFN1 (Rabbit monoclonal) | Cell Signaling Technology | 14,739 S | WB (1:1000) |
| Antibody | anti-MFN2 (Mouse monoclonal) | Abcam | ab56889 | WB (1:1000) |
| Antibody | anti-MFN2 (Mouse monoclonal) | Abcam | ab56889 | WB (1:1000) |
| Antibody | anti-TOM20 (Mouse monoclonal) | Santa Cruz | sc-17764 | WB (1:500) |
| Antibody | anti-TOM20 (Rabbit polyclonal) | Abcam | ab78547 | ICC (1:1000) |
| Antibody | anti-Tubulin (Rat monoclonal) | Abcam | ab6160 | WB (1:2000) |
| Antibody | anti-GFP (Chicken polyclonal) | Abcam | ab13970 | WB (1:10000) ICC (1:2000) |
| Antibody | anti-actin (Rabbit polyclonal) | Sigma-Aldrich | A2103 | WB (1:2000) |
| Antibody | anti-COX IV (Mouse monoclonal) | Abcam | ab14744 | WB (1:1000) |
| Antibody | anti-MEK1/2 (Mouse monoclonal) | Cell Signaling Technology | 4,694 S | WB (1:1000) |
| Recombinant DNA reagent | pDEST-GJA1-20k-GFP (plasmid) | Fu et al., 2017 (DOI: 10.3389/fphys.2017.00905) | GFP version of Addgene_#49,861 |
|
| Recombinant DNA reagent | pDEST-GST-GFP (plasmid) | Fu et al., 2017 (DOI: 10.3389/fphys.2017.00905) | ||
| Recombinant DNA reagent | pDEST-LifeAct-mCherry (plasmid) | Addgene | 40,908 | |
| Recombinant DNA reagent | pDEST-LifeAct-mCherry (plasmid) | Addgene | 40,908 | |
| Recombinant DNA reagent | mCherry-Drp1 (plasmid) | Addgene | 49,152 | |
| Recombinant DNA reagent | pcDNA3-Drp1K38A (plasmid) | Addgene | 45,161 | |
| Sequenced-based reagent | siRNA: Negative Control | Thermo Fisher Scientific | 12935300 | Stealth RNAi |
| Sequenced-based reagent | Gja1_Fw | This paper | PCR primer | GGGGACAAGTTTGTACAAAAAAGCAGGCTT CAGGAGGTATACATATGCATCATCATCATCAT CACGGTGGTGGCGGTTCAGGCGGAGGTGG CTCTGTTAAGGATCGGGTTAAGGGAAAG |
| Sequenced-based reagent | Gja1_Rv | This paper | PCR primer | GGGGACCACTTTGTACAAGAAAGCTGGGTC TTACTAATCGTCATCATCGTCATCATCGTCATC ATCACTTCCACCACTTCCACCGATCT CCAGGTCATCAGGCCG |
| Peptide, recombinant protein | GJA1-20k | This paper | amino acids 236–382 of the full-length human Cx43, NCBI reference NP 000156,1 |
|
| Commercial assay or kit | DC Protein Assay | Bio-Rad | 5000116 | |
| Commercial assay or kit | Actin Polymerization Biochem Kit | Cytoskeleton, Inc | BK003 | |
| Commercial assay or kit | Mouse Mitochondrial DNA Copy Number Assay kit | Detroit R&D | NC1134958 | |
| Commercial assay or kit | Human Mitochondrial DNA Monitoring Primer Set | TaKaRa Bio | 7,246 | |
| Commercial assay or kit | Primary Cardiomyocyte Isolation Kit | Life Technologies | 88,281 | |
| Commercial assay or kit | Mitochondria Isolation Kit | Thermo Fisher Scientific | 89,874 | |
| Commercial assay or kit | ATPlite Luminescence Assay System | PerkinElmer | 6016943 | |
| Commercial assay or kit | HisPur Cobalt Purification Kit | Thermo Fisher Scientific | PI-90092 | |
| Chemical compound, drug | FuGene HD | Promega | E2312 | |
| Chemical compound, drug | Lipofectamine RNAiMAX | Thermo Fisher Scientific | 13778150 | |
| Chemical compound, drug | mitochondrial division inhibitor 1 | Sigma-Aldrich | M0199 | 50 µM |
| Chemical compound, drug | Latrunculin A | Sigma-Aldrich | L5163 | 100 nM |
| Chemical compound, drug | Mitotracker Deep Red | Thermo Fisher Scientific | m22426 | 200 nM |
| Chemical compound, drug | Mitotracker Red CMXRos | Thermo Fisher Scientific | M7512 | 200 nM |
| Chemical compound, drug | TMRE | Cayman Chemical Company | 701,310 | 200 nM |
| Chemical compound, drug | MitoSOX Red Mitochondrial Superoxide Indicator | Thermo Fisher Scientific | M36008 | 5 µM |
| Chemical compound, drug | CellROX Deep Red | Thermo Fisher Scientific | C10422 | 5 µM |
| Chemical compound, drug | ProLong Gold antifade regent with DAPI | Thermo Fisher Scientific | P36935 | |
| Software, algorithm | GraphPad Prism 6.0 | GraphPad Software Inc | Windows | |
| Software, algorithm | ImageJ | NIH | Windows | |
| Software, algorithm | Mitochondria morphology plugin | Dagda, Cherra et al. 2009 (DOI: 10.1074/jbc.M808515200) | ||
| Software, algorithm | Chemidoc MP imaging system | Bio-Rad | ||
| Software, algorithm | Image Lab software | Bio-Rad | ||
| Software, algorithm | Adobe Photoshop | Adobe | Version 22.4.2 | |
| Software, algorithm | Adobe Illustrator | Adobe | Version 25.3.1 | |
| Other | triphenyl tetrazolium chloride (Stain) | Sigma-Aldrich | T8877 | |
| Other | dihydroethidium (Stain) | Thermo Fisher Scientific | D23107 |