REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-human IgG conjugated with an IRDye 800CW	Rockland	Cat#926-32232
Anti-rabbit IgG conjugated with an IRDye 800CW	Rockland	Cat#925-32211
Goat anti-llama IgG (H+L) secondary antibody with HRP	Novus	Cat# NB7242
Anti-M13 bacteriophage antibody with HRP	Sino Biological	Cat#11973-MM05T-H
Rabbit anti-SARS-CoV-N IgG	Sino Biological	Cat#40143-R019
HRP-conjugated goat anti-rabbit IgG (H+L) antibody	Jackson ImmunoResearch	Cat#111-035-003
SARS-CoV/SARS-CoV-2 Nucleocapsid Antibody, Mouse mAb	Sino Biological	Cat#40143-MM05
SNB02	Y-Clone	Cat#YL2018-003
Nanobody against HSA (NbH)	Abrev	Cat#AR2020-010
Bacterial and virus strains
TG1 bacteria	Y-Clone	N/A
M13KO7 helper phage	Invitrogen	Cat#18311019
SARS-CoV-2 live virus of Beta/Shenzhen/SZTH-003/2020 for cell assay	Shenzhen Third People’s Hospital	EPI_ISL_406594 at GISAID
SARS-CoV-2 pseudovirus and its variants	This Paper	N/A
SARS-CoV pseudovirus	This Paper	N/A
Mers-CoV Pseudovirus	This Paper	N/A
SARS-CoV-2 live virus for animal study	Wuhan Institute of Virology	IVCAS 6.7512
Biological samples
Nb Phage library	This Paper	C9-Nb-lib
Chemicals, peptides, and recombinant proteins
SARS-CoV-2 Spike protein (S1+S2 ECD, S)	Sino Biological	Cat#40589-V08B1
SARS-CoV-2 RBD protein	Sino Biological	Cat#40592-V08H
Freund’s complete adjuvant	Sigma	Cat#F5881-10ML
Freund’s incomplete adjuvant	Sigma	Cat#F5506-10M
3,3′,5,5′-Tetramethylbenzidine	Sigma	Cat#54827-17-7
Ficoll-Paque Plus	GE	Cat#17-1140-02
TRIzol reagent	Life Technologies	Cat#15-596-018
KPL TrueBlue Peroxidase Substrates	SeraCare Life Sciences Inc.	Cat#5510-0030
10% neutral buffered formalin	Sigma	Cat# Z2902
Far infrared dye YF®750 SE	US EVERBRIGHT INC	YS0056
Critical commercial assays
Anti-human Fc (AHC) biosensors	Fortebio	Cat#18-5060
AR2G biosensor	Fortebio	Cat#18-5092
Amino coupling kit	Fortebio	Cat#18-5095
RT-PCR Prime Script Kit	Takara	Cat#PR005B
Experimental models: Cell lines
HEK293T-ACE2 cells	Yeasen Biotech	Cat# 41107ES0
Huh7 cells	ATCC	CCL-185
293T cells	ATCC	CRL-3216
293-F cells	Thermo Fisher Scientific	R79007
Experimental models: Organisms/strains
Transgenic hACE2 mice (C57BL/6J)	GemPharmatech	Cat T037630
Alpaca	Y-Clone	AR-0019
BALB/c	Qing Long Shan Animal Center	Qls02-0202
Nude mice	Qing Long Shan Animal Center	Qls03-0102
Oligonucleotides
TaqMan probe (5′-FAM− CAGGT GGAACCTCATCAGGAGATGC −MGB-3′)	This paper	N/A
Primer of orf1ab gene of SARS-CoV-2 Forward: (5′- GTGARATGGTCATGTGTGGCGG −3′′)	This paper	N/A
Primer of orf1ab gene of SARS-CoV-2 Reverse: (5′- CARATGTTAAASACACTATTAGCATA −3′)	This paper	N/A
Recombinant DNA
pCDNA3.1-S encoding spike protein of variant coronavirus	This paper	N/A
pCDNA3.4 eukaryotic expression vector	Invitrogen	Cat#A14697
HIV-1 NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-)	HIV AIDS Reagent Program	Cat#3418
phV1 phagemid plasmid	Y-Clone	N/A
pcDNA3.4-Nbs	This paper	N/A
Software and algorithms
GraphPad Prism 8.01	GraphPad Software Inc.	https://www.graphpad.com/scientific-software/prism/; RRID:SCR_002798
ImageJ	https://imagej.nih.gov/ij/	https://imagej.nih.gov/ij/; RRID: SCR_001935
Indigo imaging software	Berthold	https://www.berthold.com/en/bioanalytic/products/in-vivo-imaging-systems/nightowl-lb983/
OriginPro 8.5 software	OriginLab	https://www.originlab.com/; RRID:SCR_014212
Others
96-well plates	Corning	Cat# 9018
Protein G	Thermo Fisher Scientific	Cat# 20399
Ni-NTA	Thermo Fisher Scientific	Cat#R901100