Table 2.
RNAi target sequences.
| Target gene | Name | Sequence of oligonucleotide (5’–3’) | Accession No. |
|---|---|---|---|
| chDDX1 | shDDX1-1 | GCTTTCAGCATTCCGGTTATC | NM_204563.1 |
| shDDX1-2 | GCAACTAGAGGTGTGACTAAA | ||
| Negative control | shNC | GTTCTCCGAACGTGTCACGT |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.