KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-IFI16 (1G7) | Santa Cruz | Cat# sc-8023; RRID:AB_627775 |
| Rat monoclonal anti-GAPDH | Biolegend | Cat# 607902; RRID:AB_2734503 |
| Mouse monoclonal anti-GAPDH | Santa Cruz | Cat# sc-365062; RRID:AB_10847862 |
| Rabbit polyclonal anti-p65 | Santa Cruz | Cat# sc-372; RRID:AB_632037 |
| Mouse monoclonal anti-HA | Abcam | Cat# ab18181; RRID:AB_444303 |
| Rabbit polyclonal anti-Sp1 | Abcam | Cat# ab13370; RRID:AB_300283 |
| IRDye® 680RD Goat anti-Mouse IgG (H + L) | LI-COR | Cat# 926-68070; RRID:AB_10956588 |
| IRDye® 680RD Goat anti-Rabbit IgG (H + L) | LI-COR | Cat# 925-68071; RRID:AB_2721181 |
| IRDye® 800CW Goat anti-Rat IgG (H + L) | LI-COR | Cat# 926-32219; RRID:AB_1850025 |
| IRDye® 800CW Goat anti-Mouse IgG (H + L) | LI-COR | Cat# 926-32210; RRID:AB_621842 |
| Rabbit anti-p24 serum derived from immunized rabbits | Eurogentec | N/A |
| Peroxidase-AffiniPure goat anti-rabbit IgG, Fc fragment specific antibody |
Dianova | Cat# 111-035-008; RRID:AB_2337937 |
| Anti-HIV-1 p24 core antigen (MAK183) | ExBIO | Cat# 11-CM006-BULK |
| Bacterial strains | ||
| Escherichia coli XL-2 blue | Escherichia coli XL-2 blue | Escherichia coli XL-2 blue |
| XL2-Blue MRF’ TM Ultracompetent cells | Agilent Technologies | Cat# 200151 |
| Biological samples | ||
| Human: Peripheral blood mononuclear cells | DRK-Blutspendedienst BW-Hessen, Ulm, Germany |
N/A |
| Chemicals, peptides, and recombinant proteins | ||
| L-Glutamine | Pan Biotech | Cat# P04-80100 |
| Penicillin-Streptomycin | ThermoFisher | Cat# 15140122 |
| Recombinant human IL-2 | NIH AIDS Reagent | Cat# 136 |
| HiFi Cas9 nuclease V3 | IDT | Cat #1081061 |
| TransIT®-LT1 Transfection Reagent | Mirus | Cat# MIR 2305 |
| β-mercaptoethanol | Sigma Aldrich | Cat# M6250-100ML |
| HIV-1 p24 protein (ELISA standard) | Abcam | Cat# 43037 |
| KPL SureBlue TMB Microwell Peroxidase Substrate | Medac | Cat# 52-00-04 |
| Sulfuric acid concentrate for 1l standard solution 0.5 M H2SO4 | Sigma-Aldrich | Cat# 38294-1EA |
| 4X Protein Sample Loading Buffer | LI-COR | Cat# 928-40004 |
| Critical commercial assays | ||
| RosetteSep Human CD4+ T Cell Enrichment Cocktail | Stem Cell Technologies | Cat# 15062 |
| Amaxa™ 4D-Nucleofactor™ Human Activated Cell P3 Lonza Kit | Lonza | Cat# V4XP-3024 |
| Q5® High-Fidelity PCR Kit | New England Biolabs | Cat# E0555S |
| Phusion High-Fidelity PCR Kit | ThermoFisher | Cat# F553L |
| DNA Ligation Kit Ver. 2.1 | TaKaRa | Cat# 6022 |
| GalScreen | Applied Bioscience | Cat# T1027 |
| Experimental models: Cell lines | ||
| Human: HEK293T cells | ATCC | Cat# CRL-3216 RRID: CVCL_0063 |
| Human: TZM-bl cells | NIH AIDS Reagent Program | Cat# 8129 RRID: CVCL_B478 |
| Human: HAP1 cells | Horizon | Cat# HZGHC001141c002 RRID:CVCL_TQ04 |
| Human: Sp1 KO HAP1 cells | Horizon | Cat# HZGHC001141c002 RRID:CVCL_TQ04 |
| Oligonucleotides | ||
| IFI16 sgRNA: GACCAGCCCTATCAAGAAAG | IDT | N/A |
| Non-targeting control sgRNA: ACGGAGGCTAAGCGTCGCAA | IDT | N/A |
| Primers used for cloning (see Table S4) | Biomers.net | N/A |
| Recombinant DNA | ||
| Plasmid: pCG_IFI16 | (Hotter et al., 2019) | N/A |
| Plasmid: pCG_PYHIN1 | (Bosso et al., 2020a) | N/A |
| Plasmid: pCG_MNDA | (Bosso et al., 2020a) | N/A |
| Plasmid: p65 | This paper | N/A |
| Plasmid: pCG_Sp1 | (Hotter et al., 2019) | N/A |
| Plasmid: pCMV-VSV-G | Addgene | Cat# 8454 |
| Plasmid: pCR-XL-TOPO_HIV-1 M subtype B CH058.c (transmitted founder virus) | B. H. Hahn (Ochsenbauer et al., 2012) | N/A |
| Plasmid: pCR-XL-TOPO HIV-1 M subtype B pTHRO.c (transmitted founder virus) | B. H. Hahn (Ochsenbauer et al., 2012) | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of THRO | (Hotter et al., 2019) | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 3′ and 5′ LTR of CH058 | (Hotter et al., 2019) | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of THROlong-CH058 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of THROshort-CH058 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of CH058long-THRO | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of CH058short-THRO | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 5′ and 3′ LTR of THROlong-CH058 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 5′ and 3′ LTR of THROshort-CH058 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 5′ and 3′ LTR of CH058long-THRO | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 5′ and 3′ LTR of CH058short-THRO | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR of CH058long-CH058 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 5′ and 3′ LTR of THROshort-THRO | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR A349G | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M THRO with 3′ and 5′ LTR G380A | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M subtype C ZM247Fv-1 (transmitted founder virus) | B. H. Hahn (Salazar-Gonzalez et al., 2009) | N/A |
| Plasmid: pCR-XL TOPO_HIV-1 M subtype C CH185 (transmitted founder) | B. H. Hahn (Parrish et al., 2013) | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M ZM247Fv-1 with 5′ and 3′ LTR +A350 | This paper | N/A |
| Plasmid: pCR-XL TOPO_HIV-1 M CH185 with 5′ and 3′ LTR T353A | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M ZM247Fv-1 with 5′ and 3′ LTR ΔNF-κB | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M ZM247Fv-1 with 5′ and 3′ LTR ΔNF-κB +A350 | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH185 with 5′ and 3′ LTR ΔNF-κB | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH185 with 5′ and 3′ LTR ΔNF-κB T353A | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR +NF-κB | This paper | N/A |
| Plasmid: pCR-XL-TOPO_HIV-1 M CH058 with 5′ and 3′ LTR +NF-κB A349G | This paper | N/A |
| Software and algorithms | ||
| Corel DRAW 2019 | Corel Corporation | https://www.coreldraw.com/en/ |
| GraphPad Prism Version 8 | GraphPad Software, Inc. | https://www.graphpad.com RRID: SCR_002798 |
| ImageJ | Open source | https://imagej.nih.gov/ij/ |
| LI-COR Image Studio Lite Version 5.0 | LI-COR | https://www.licor.com/ RRID: SCR_013715 |
| MEGA6 | (Tamura et al., 2013) | https://www.megasoftware.net/ |