REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
BUV395 conjugated Mouse Anti-Human CD4 Antibody	BD Biosciences	Cat. #: 564724; RRID: AB_2738917
Brilliant Violet 785™ conjugated anti-human CD8a Antibody	Biolegend	Cat. #: 301046; RRID: AB_2563264
Brilliant Violet 421™ conjugated anti-DYKDDDDK Tag Antibody	Biolegend	Cat. #: 637321: RRID: AB_2750051
PE-CF594 conjugated Mouse Anti-Human Granzyme B Antibody	BD Biosciences	Cat. #: 562462: RRID: AB_2737618
Alexa Fluor® 647 conjugated Mouse Anti-Human Perforin Antibody	BD Biosciences	Cat. #: 563576: RRID: AB_2738287
Brilliant Violet 421™ conjugated anti-human CD178 (Fas-L) Antibody	Biolegend	Cat. #: 306411: RRID: AB_2716104
APC conjugated anti-DYKDDDDK Tag Antibody	Biolegend	Cat. #: 637307; RRID: AB_2561496
APC-Cy™7 conjugated Mouse Anti-Human CD69 Antibody	BD Biosciences	Cat. #: 560912; RRID: AB_396862
PE-Cyanine7 conjugated IFN gamma Monoclonal Antibody (XMG1.2)	Invitrogen	Cat. #: 25-7311-82; RRID: AB_469680
Recombinant Anti-SARS-CoV-2 Spike Glycoprotein S1 antibody [CR3022]	Abcam	Cat. #: ab273074; RRID: AB_2847846
SARS/SARS-CoV-2 Coronavirus Spike Protein (subunit 1) Polyclonal Antibody	Invitrogen	Cat. #: PA5-81795; RRID: AB_2788969
CD178 (Fas Ligand) Monoclonal Antibody (NOK-1)	Invitrogen	Cat. #: 16-9919-81; RRID: AB_469281
Human Fas Ligand/TNFSF6 Antibody	R&D Systems	Cat. #: MAB126-SP; RRID: AB_2246667
Human ACE-2 Antibody	R&D Systems	Cat. #: AF933-SP; RRID: AB_355722
anti-human CD3 Antibody (OKT-3)	Bio X Cell	Cat. #: BE0001-2; RRID: AB_1107632
anti-human CD28 Antibody (9.3)	Bio X Cell	Cat. #: BE0248; RRID: AB_2687729
FITC conjugated Rabbit anti-Goat IgG (H+L) Secondary Antibody	Invitrogen	Cat. #: 31509; RRID: AB_228394
Alexa Fluor® 647 conjugated Donkey anti-rabbit IgG (minimal x-reactivity) Antibody	Biolegend	Cat. #: 406414; RRID: AB_2563202
eFluor® 450 conjugated Phospho-S6 (Ser235, Ser236) Monoclonal Antibody (cupk43k)	Invitrogen	Cat. #: 48-9007-42; RRID: AB_2574117
Normal Rabbit IgG Control	R&D Systems	Cat. #: MAB1050-500; RRID: AB_2313773
Ultra-LEAF™ Purified Mouse IgG1, κ Isotype Ctrl Antibody	Biolegend	Cat. #: 400166; RRID: AB_2313773
Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl Antibody	Biolegend	Cat. #: 400348; RRID: AB_2313773
Bacterial and virus strains
Pseudotyped ΔG-DsRed (G∗ΔG-DsRed) rVSV	Kerafast	Cat. #: EH1018-PM
NEB® Stable Competent E. coli	New England Biolabs	Cat. #: C3040I
Biological samples
Human Peripheral blood mononuclear cells	HÉMA-QUÉBEC	https://www.hema-quebec.qc.ca/index.fr.html
Chemicals, peptides, and recombinant proteins
Fixable Viability Stain 575V	BD Biosciences	Cat. #: 565694; RRID: AB_2869702
Fixable Viability Dye eFluor™ 780	Invitrogen	Cat. #: 65-0865-14;
X-tremeGENE™ HP DNA Transfection Reagent	Roche	Cat. #: 6366236001;
Tag-it Violet™ Proliferation and Cell Tracking Dye	Biolegend	Cat. #: 425101;
X-VIVOTM 15 Serum-free Hematopoietic Cell Medium	Lonza	Cat. #: 04-418Q
Protamine sulfate salt from salmon	Sigma-Aldrich	Cat. #: P4020
Human Recombinant IL-2, ACF	STEMCELL	Cat. #: 78145
Protein Transport Inhibitor (Containing Brefeldin A)	BD Biosciences	Cat. #: 555029; RRID: AB_2869014
SARS-CoV-2 (COVID-19) S protein RBD, His Tag	Acrobiosystem	Cat. #: SPD-C52H3
Biotinylated SARS-CoV-2 (COVID-19) S1 protein, His,Avitag™	Acrobiosystem	Cat. #: S1N-C82E8
Phorbol 12-myristate 13-acetate	Sigma-Aldrich	Cat. #: P8139
Ionomycin from Streptomyces conglobatus	Sigma-Aldrich	Cat. #: I9657
IVISbrite D-Luciferin Ultra Bioluminescent Substrate in RediJect Solution (XenoLight)	PerkinElmer	Cat. #: 770505
Hygromycin B	Gibco	Cat. #: 10687010
Critical commercial assays
Intracellular Fixation & Permeabilization Buffer Set	Invitrogen	Cat. #: 88-8824-00;
Foxp3 / Transcription Factor Staining Buffer Set	Invitrogen	Cat. #: 00-5523-00
CytoTox 96® Non-Radioactive Cytotoxicity Assay	Promega	Cat. #: G1780
Platinum™ SuperFi II Green PCR Master Mix	Invitrogen	Cat. #: 12369010
Wizard® SV Gel and PCR Clean-Up System	Promega	Cat. #: A9281
Wizard® Plus SV Minipreps DNA Purification Systems	Promega	Cat. #: A1330
Q5 Site-Directed Mutagenesis Kit	New England Biolabs	Cat. #: E0554S
NucleoBond® Xtra Maxi EF Kit	TAKARA	Cat. #: 740424.10
Quick Ligation™ Kit	New England Biolabs	Cat. #: M2200S
Deposited data
raw data in this study	This paper	https://doi.org/10.17632/3y3m8btcnk.2
Experimental models: Cell lines
293T	ATCC	Cat. #: CRL-3216
Vero	ATCC	Cat. #: CCL-81
Jurkat E6-1	ATCC	Cat. #: TIB-152
293-hACE2	Laboratory of H. Uri Saragovi	N/A
NIH/3T3-SARS-CoV-2 S1	Laboratory of H. Uri Saragovi	N/A
NIH/3T3-SARS-CoV-2 S1-mCherry-luciferase	This paper	N/A
Experimental models: Organisms/strains
NOD-SCID IL2Rγnull mice	The Jackson Laboratory	Cat. #: 005557
Oligonucleotides
Flag-F for mutagenesis: GATTACAAGGACGATGACGAC	This paper	N/A
Flag-R for mutagenesis: gtccttgtaatcGCAGATGGCGTCGGTGATC	This paper	N/A
IgG4CH3-F for mutagenesis: GGCCAGCCAAGAGAACC	This paper	N/A
IgG4CH3-R for mutagenesis: AGGACATGGAGGACAAGGAG	This paper	N/A
HIV-F for sequencing: TCAAGCCTCAGACAGTGGTTC	This paper	N/A
HIV-R for sequencing: AAGCGGCTTCGGCCAGTAAC	This paper	N/A
CR3022-F for sequencing: AATACCGCCTACCTGCAGTG	This paper	N/A
Recombinant DNA
pHIV-EGFP	Addgene	Cat. #: 18121; RRID: Addgene_18121
pMD2.G	Addgene	Cat. #: 12259; RRID: Addgene_12259
psPAX2	Addgene	Cat. #: 12260; RRID: Addgene_12260
pCDH-EF1a-eFFly-mCherry	Addgene	Cat. #: 104833; RRID: Addgene_104833
pGBW-m4137382	Addgene	Cat. #: 149539; RRID: Addgene_149539
pHIV-Flag-28Z-EGFP	This paper	N/A
pHIV-CR3014-28Z-EGFP	This paper	N/A
pHIV-CR3022-28Z-EGFP	This paper	N/A
pHIV-CR3022-8a-28Z-EGFP	This paper	N/A
pHIV-CR3022-CH3-28Z-EGFP	This paper	N/A
pHIV-CR3022-IgG4-28Z-EGFP	This paper	N/A
Software and algorithms
FlowJo V10.0	Tree Star	https://www.flowjo.com/
Premium Cytobank	Cytobank	https://www.cytobank.org/
ZEN Lite	Zeiss	https://www.zeiss.com/microscopy/int/home.html
Aura Imaging Software V3.2	Spectral Instruments Imaging	https://spectralinvivo.com/
Living Image Software	PerkinElmer	https://www.perkinelmer.com/
GraphPad Prism® software v8.0	GraphPad	https://www.graphpad.com
Other
cover-glass bottom dish	SPL life sciences	Cat. #: 100350