| Cell line (Mus musculus) |
C2C12 |
ATCC |
Cat# CRL-1772, RRID: CVCL_0188
|
Myoblast cell line |
| Cell line (M. musculus) |
NIH3T3 |
ATCC |
Cat# CRL-1658, RRID:CVCL_0594
|
Fibroblast cell line |
| Cell line (Homo sapiens) |
HEK293T |
ATCC |
Cat# PTA-4488,RRID:CVCL_0045
|
|
| Cell line (H. sapiens) |
Human myoblast healthy donor |
(Holt, 2016; Mamchaoui et al., 2011); Institute de Myologie, Paris |
|
|
| Cell line (H. sapiens) |
Human myoblast patient-derived |
(Holt, 2016; Mamchaoui et al., 2011); Institute de Myologie, Paris |
|
Mutation in the SYNE1 gene (23560 G>T causing a premature stop and loss nesprin-1α expression) |
| Antibody |
Anti-PCM1 (rabbit polyclonal) |
Santa Cruz |
Cat# sc-67204, RRID:AB_2139591
|
WB (1:500), IF (1:200) |
| Antibody |
Anti-AKAP6 (rabbit polyclonal) |
Sigma-Aldrich |
Cat# HPA048741, RRID:AB_2680506
|
WB (1:2000), IP/IF (1:500) |
| Antibody |
Anti-PCM1 (mouse monoclonal) |
Santa Cruz |
Cat# sc-398365, RRID:AB_2827155
|
IF (1:200) |
| Antibody |
Anti-nesprin-1 (MANNES1E) (mouse monoclonal) |
G.Morris (Randles et al., 2010) |
|
IF (1:50) |
| Antibody |
Anti-myogenin (mouse monoclonal) |
Santa Cruz |
Cat# sc-12732, RRID:AB_627980
|
IF (1:500) |
| Antibody |
Anti-MyoD1 (mouse monoclonal) |
Millipore |
Cat# MAB3878, RRID:AB_2251119
|
IF (1:500) |
| Antibody |
Anti-tubulin (rat monoclonal) |
Sigma-Aldrich |
Cat# T9026, RRID:AB_477593
|
IF (1:500) |
| Antibody |
Anti-Troponin I (goat polyclonal) |
Abcam |
Cat# ab56357, RRID:AB_880622
|
IF (1:500) |
| Antibody |
Anti-γ-tubulin (mouse monoclonal) |
Santa Cruz |
Cat# sc-51715,RRID:AB_630410
|
IF (1:100) |
| Antibody |
Anti-AKAP9 (rabbit polyclonal) |
Sigma-Aldrich |
Cat# HPA026109, RRID:AB_1844688
|
IF (1:200) |
| Antibody |
Anti-Pericentrin (rabbit polyclonal) |
BioLegend |
Cat# PRB-432C, RRID:AB_291635
|
IF (1:1000) |
| Recombinant DNA reagent |
psiCHECK-2 vector |
Promega |
Cat# C8021; GenBank Accession Number AY535007
|
|
| Recombinant DNA reagent |
peGPF-N1 |
Clontech |
Cat# 6085-1; GenBank Accession Number U55762
|
|
| Recombinant DNA reagent |
psPAX2 |
D.Trono (Addgene) |
Addgene plasmid #12260; RRID: Addgene_12260
|
Lentiviral packaging plasmid |
| Recombinant DNA reagent |
pMD2.G |
D.Trono (Addgene) |
Addgene plasmid #12259; RRID: Addgene_12259
|
Lentiviral VSV-G envelope plasmid |
| Recombinant DNA reagent |
pLenti CMVtight Blast DEST (w762-1) |
E.Campeau (Addgene) |
Addgene plasmid #26434; RRID: Addgene_26434
|
Lentiviral transfer plasmid for Tet-ON system |
| Recombinant DNA reagent |
pLenti CMV rtTA3 Hygro (w785-1) |
E.Campeau (Addgene) |
Addgene plasmid #26730; RRID: Addgene_26730
|
Lentiviral transfer plasmid for Tet-ON system |
| Recombinant DNA reagent |
mScarlet |
D.Gadella (Addgene) |
Addgene plasmid #85042; RRID: Addgene_85042
|
|
| Sequence-based reagent |
MyoD1 cold fusion cloning forward |
This paper |
Cloning PCR primer |
gggatccaccggtcgccac catggagcttctatcgccgcc |
| Sequence-based reagent |
MyoD1 cold fusion cloning reverse |
This paper |
Cloning PCR primer |
tcctcgcccttgctcacc ataagcacctgataaatcgcat |
| Sequence-based reagent |
Myog cold fusion cloning forward |
This paper |
Cloning PCR primer |
gggatccaccggtcgccaccatggagctgtatgagacatc |
| Sequence-based reagent |
Myog cold fusion cloning reverse |
This paper |
Cloning PCR primer |
tcctcgcccttgctcaccatgttgggcatggtttcgtctg |
| Sequence-based reagent |
myogenin siRNA |
Integrated DNA technologies |
Cat# mm.Ri.Myog.13.1 |
AAUAAAGACUGGUUGCUAUCAAAAA |
| Sequence-based reagent |
Akap6 siRNA |
Thermo Fischer Scientific |
Cat# 4390771 s108732 |
GGACUACAUCAAGAACGAATT |
| Sequence-based reagent |
Syne1 siRNA |
Integrated DNA technologies |
Cat# mm.Ri.Syne1.13.1 |
AACUAGAGCUUAUCAACAAACAGTA |
| Sequence-based reagent |
Pcm1 siRNA |
Integrated DNA technologies |
Cat# mm.Ri.Pcm1.13.1 |
AGUCAGAUUCUGCAACAUGAUCUTG |
| Sequence-based reagent |
Negative control (si-ctrl) siRNA |
Integrated DNA technologies |
Cat# 51-01-14-04 |
Non-targeting |
| Commercial assay or kit |
Dual‐Luciferase Reporter Assay System |
Promega |
Cat# E1910 |
|
| Chemical compound, drug |
Doxycycline hydrochloride |
Sigma-Aldrich |
Cat# D3447 |
|
| Chemical compound, drug |
Bovine fetuin |
Thermo Fisher Scientific |
Cat# 10344026 |
|
| Chemical compound, drug |
EGF Recombinant Human Protein |
Thermo Fisher Scientific |
Cat# PHG0311 |
|
| Chemical compound, drug |
FGF-Basic (AA 10-155) Recombinant Human Protein |
Thermo Fisher Scientific |
Cat# PHG0026 |
|
| Chemical compound, drug |
Insulin-Transferrin-Selenium-Sodium Pyruvate (ITS-A) (100X) |
Thermo Fisher Scientific |
Cat# 51300044 |
|
| Software, algorithm |
Fiji software package |
http://fiji.sc/
|
RRID:SCR_002285
|
|
| Software, algorithm |
Bioconductor |
http://www.bioconductor.org/
|
RRID: SCR_006442
|
|
| Other |
Skeletal Muscle Differentiation Medium |
PromoCell |
Cat# C-23061 |
|
| Other |
Horse serum |
Thermo Fisher Scientific |
Cat# 16050122 |
|
