REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal glutamylated tubulin (GT335)	Adipogen	Cat# AG-20B-0020-C100; RRID: AB_2490210
GFP Polyclonal Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Cat # A-21311, RRID:AB_221477
Alexa fluor plus Goat anti mouse 488	Thermo Fisher Scientific	Cat # A32723; RRID:AB_2633275
Alexa fluor plus Goat anti rabbit 555	Thermo Fisher Scientific	Cat# A32732; RRID:AB_2633281
Beta catenin	cell signaling technologies	Cat# 9562; RRID:AB_331149
Alexa fluor plus Goat anti mouse 555	Thermo Fisher Scientific	Cat# A32727, RRID:AB_2633276
Chemicals, peptides, and recombinant proteins
Dapi	Thermo Fisher Scientific	Cat# D1306; RRID:AB_2629482
x2 power up SYBR master mix	Thermo Fisher Scientific	Cat# A25742
Microamp optical 96 well reaction plate (Applied biosystems)	Thermo Fisher Scientific	Cat# N8010560
70 kDa rhodamine B isothiocyanate-dextran	Sigma-Aldrich	Cat# R9379
SPHERO Fluorescent Yellow Particles 1% w/v, F = 1 μm	Spherotech	Cat# FP-1552-2
Phosphate buffered saline	Thermofisher	Cat# BR0014G
Triton X-100	Merck	Cat# 1086031000
Bovine Serum Albumin (BSA)	PanReac AppliedChem	Cat# A1391
Dimethyl sulfoxide (DMSO)	Sigma	Cat# D8418
Glycerol	VWR	Cat# 24387.292
Acetone	VWR	Cat# 20066.296
Formaldehyde solution (PFA)	Sigma	Cat# F8775-25ml
MS-222	Sigma	Cat# E10621-60G
Proteinase K from tritirachium album	Sigma	Cat# P2308-25MG
Tris	Sigma	Cat# 252859-100G
CellTracker Red CMTPX Dye	Thermofisher	Cat# C34552
Neg-50 Frozen Section Medium	VWR	Cat# 6502
Critical commercial assays
multiplex HCRv3 reagents	Molecular Instruments	https://www.molecularinstruments.com/
Deposited data
Single cell RNA data	This paper	GEO: GSE161834
Raw and analyzed data	This paper	Mendeley Data: https://doi.org/10.17632/ygy3pnbnxn.1
Experimental models: Organisms/strains
T2BGSZ10 Gt(Foxj1b:GFP)	Meng lab, Tsinghua University (Tian et al., 2009)	ZFIN: ZDB-ALT-110301-1
Gmnc mutant (gmncsq34)	Roy lab, A∗STAR (Zhou et al., 2015)	ZFIN: ZDB-ALT-160901-7
Foxj1b mutant (foxj1bsq5719)	Roy lab, A∗STAR	This study
Foxj1a mutant (foxj1anw3)	Yaksi lab, NTNU (Olstad et al., 2019)	ZFIN: ZDB-ALT-190620-14
Foxj1a mutant (foxj1asq5717)	Roy lab, A∗STAR (Zhang et al., 2018)	ZFIN: ZDB-ALT-190529-1
Tg(foxj1a:gfp)BACvcc41	Kikuchi lab, NCVC	This study
Tg(Hs:foxj1a)sq5713Tg	Roy lab, A∗STAR (Yu et al., 2008)	ZFIN: ZDB-ALT-141111-1
Tg(her4.1:GFP)	Yeo et al., 2007	ZFIN: ZDB-ALT-070612-3
Nacre mitfab692	Lister et al., 1999	ZFIN:ZDB-ALT-010919-2
Oligonucleotides
Gmnc genotyping crispr deletion Forward TTGTGATTGTCTCATGCTGTTG	IDT	N/A
Gmnc genotyping crispr deletion Reverse AAAAATTCCAGTTTGTCAAGGC	IDT	N/A
Foxj1b genotyping crispr deletion Forward TCTTCAGACCAGCAAAGACAGT	IDT	N/A
Foxj1b genotyping crispr WT allele Reverse CTCCATCCTCAGTGCCAACC	IDT	N/A
Foxj1b genotyping crispr deletion Mutant allele Reverse CGGC TCTGCGTATCTGTAGT	IDT	N/A
foxj1anw3 genotyping Forward GCTGGTCAGGCTGTCGTCTAAA	IDT	N/A
foxj1anw3 genotyping Reverse CGCTATCGAGGAAGGACAGGATTT	IDT	N/A
foxj1bsq5719 genotyping Forward GAGCTAACCAAATCA ATCGGGG	IDT	N/A
foxj1bsq5719 genotyping WT allele Reverse CGTAAGTTCGCGCAGGATTG	IDT	N/A
foxj1bsq5719 genotyping Mutant allele Reverse ATCCAGTAGAGCGTCCCA GT	IDT	N/A
Software and algorithms
ImageJ/Fiji		Schindelin et al., 2012
CiliaQ	Wachten lab, University of Bonn	Hansen et al., 2020
Other
Pressure injector	Eppendorf	Femtojet 4i
Confocal microscope	Zeiss	Examiner Z1; Olympus Fluoview
Optical Coherence Tomography	Thorlabs	Telesto 1300nm SD-OCT and LK-4 objective
Step One Real Time PCR system	Thermofisher	Cat# 4376357
Cryostat	Thermo Scientific	CryoStar NX70
Molecular Cartography	Resolve Biosciences	N/A