REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rat monoclonal anti-mouse-CD45R/B220 PE-CF594(clone RA3-6B2) | BD Biosciences | Cat#562290; RRID: AB_11151901 |
Rat monoclonal anti-mouse-CD19 APC-Cy7(clone 1D3) | BD Biosciences | Cat#557655; RRID: AB_396770 |
Rat monoclonal anti-mouse-IgM PE-Cy7(clone II/41) | Invitrogen | Cat#25-5790-82; RRID: AB_469655 |
Fluorescein (FITC)-AffiniPure Goat Anti-Mouse IgM, μ Chain Specific | Jackson Immunoresearch | Cat#115-095-075; RRID: AB_2338598 |
Rat monoclonal anti-mouse-IgD BV711 (clone 11-26c.2a) | BioLegend | Cat#405731; RRID: AB_2563342 |
Rat monoclonal anti-mouse-GL-7 PE (clone GL7) | BD Biosciences | Cat#561530; RRID: AB_10715834 |
Rat monoclonal anti-mouse-CD38 Alexa Fluor 700 (clone 90) | Invitrogen | Cat#56-0381-82; RRID: AB_657740 |
Rat monoclonal anti-mouse-CD8a PerCP-Cy5.5 (clone 53-6.7) | Invitrogen | Cat#45-0081; RRID: AB_1107004 |
Rat monoclonal anti-mouse-GL-7 FITC (clone GL7) | BioLegend | Cat#144603; RRID: AB_2561696 |
Rat monoclonal anti-mouse/human-IRF4 EF450 (clone 3E4) | Invitrogen | Cat#48-9858-82; RRID: AB_2574135 |
Biotin Rat Anti-Mouse IgG1(clone A85-1) | BD Biosciences | Cat#553441; RRID: AB_394861 |
Biotin Mouse Anti-Mouse IgG2a [b] (clone 5.7) | BD Biosciences | Cat#553504; RRID: AB_394889 |
Goat polyclonal Secondary Antibody to Monkey IgG - H&L (HRP) | Abcam | Cat#ab112767 |
Goat Anti-Mouse IgM-HRP | SouthernBiotech | Cat#1021-05; RRID: AB_2794240 |
Goat Anti-Mouse IgG2c, Human ads-HRP | SouthernBiotech | Cat#1079-05; RRID: AB_2794466 |
Goat Anti-Mouse IgG1, Human ads-HRP | SouthernBiotech | Cat#1070-05; RRID: AB_2650509 |
Goat Anti-Mouse IgG2b, Human ads-HRP | SouthernBiotech | Cat#1090-05; RRID: AB_2794521 |
Goat Anti-Mouse IgG3, Human ads-HRP | SouthernBiotech | Cat#1100-05; RRID: AB_2794573 |
Goat anti-Mouse IgA Heavy Chain Antibody HRP Conjugated | Bethyl Laboratories | Cat# A90-103P |
Goat anti-Mouse IgG-Fc Fragment Antibody HRP Conjugated | Bethyl Laboratories | Cat# A90-131P |
Goat anti-Mouse IgG-Fc Fragment Antibody Affinity Purified | Bethyl Laboratories | Cat# A90-131A |
IFN gamma Monoclonal Antibody (clone AN-18), Functional Grade | Invitrogen | Cat#16-7313-85; RRID: AB_469247 |
IFN gamma Monoclonal Antibody (clone R4-6A2), Biotin | Invitrogen | Cat#13-7312-85; RRID: AB_466939 |
IgD Monoclonal Antibody (clone 11-26c), Biotin | Invitrogen | Cat#13-5993-82; RRID: AB_466860 |
BV650 streptavidin | BioLegend | Cat#405231 |
PE streptavidin | BioLegend | Cat#405204 |
HRP-conjugated streptavidin | Jackson Immunoresearch | Cat#016-030-084; RRID: AB_2337238 |
Bacterial and virus strains | ||
E. coli BL21(DE3) | TransGen Biotech | Cat# CD601 |
SARS-CoV-2 (nCoV-2019BetaCoV/Wuhan/WIV04/2019) | The National Virus Resource, China | N/A |
SARS-CoV-2 strain 107 | The Guangdong Provincial Center for Disease Control and Prevention, Guangdong, China | N/A |
Chemicals, peptides, and recombinant proteins | ||
CpG-ODN | Shanghai Generay Biotech | Sequence:TCCATGACGTTCCTGACGTT |
Isopropyl β-D-1-thiogalactopyranoside (IPTG) | Yeasen biotech, China | Cat#367-93-1 |
Polyethylenimine (PEI) | Polyscience | Cat#23966-1 |
3,3′-Diaminobenzidine tetrahydrochloride hydrate | Sigma-Aldrich | Cat# D5637-1G |
3,3′,5,5′-Tetramethylbenzidine | Sigma-Aldrich | Cat#860336-1G |
Fast Red | Sigma-Aldrich | Cat# F8764-1G |
D-biotin | BBI Life Sciences | Cat# A100340-0500 |
Imject Alum | Thermo | Cat# 77161 |
RBD peptides pool1 | Smith, 2020 #31 | N/A |
RBD peptides pool2 | Smith, 2020 #31 | N/A |
Recombinant AP205 protein | This paper | N/A |
Recombinant AP205-SpyTag protein | This paper | N/A |
Recombinant RBD protein | This paper | N/A |
Recombinant RBD-SpyCatcher protein | This paper | N/A |
Recombinant RBD-AviTag protein | This paper | N/A |
Recombinant GST-BirA protein | This paper | N/A |
Recombinant S protein | This paper | N/A |
Critical commercial assays | ||
Toxin Sensor Chromogenic LAL Endotoxin Assay Kit | GenScript | Cat# L00350C |
Alexa Fluor 647 Protein Labeling Kit | Invitrogen | Cat# A20173 |
THUNDERBIRD Probe One-Step qRT-PCR kit | TOYOBO | Cat# QRZ-101 |
High Pure Viral RNA Kit | Roche | Cat#11858882001 |
TRIzol Plus RNA Purification Kit | Thermo Fisher | Cat# A33254 |
MiniBEST Viral RNA/DNA Extraction Kit | TaKaRa | Cat#9766 |
PrimeScript RT reagent Kit with gDNA Eraser | Takara | Cat# RR047A |
Ni-NAT 5mL (Pre-Packed Gravity Column) | BBI Life Sciences | Cat# C600793-0010 |
GST Fusion Protein Purification Kit | GenScript | Cat# L00207 |
Bright-Glo Luciferase Assay Vector System | Promega | Cat# E2650 |
Experimental models: Cell lines | ||
Expi293F | GIBCO | Cat# A14635 |
Vero-E6 | ATCC | CRL-1586; RRID: CVCL_0574 |
Human: HEK293T | ATCC | Cat# CRL-11268 |
Human: Huh7 | NICR | Cat#1101HUM-PUMC000679 |
Experimental models: Organisms/strains | ||
C57BL/6 | The Institute of Biophysics, Chinese Academy of Sciences | N/A |
Rhesus macaques | Kunming Institute of Zoology (KIZ), Chinese Academy of Sciences (CAS) | N/A |
Oligonucleotides | ||
SARS-CoV-2- forward primer: 5′-GGGGAACTTCTCCTGCTAGAAT-3′ | Song, 2020 #37 | N/A |
SARS-CoV-2- reverse primer: 5′-CAGACATTTTGCTCTCAAGCTG-3′ | Song, 2020 #37 | N/A |
SARS-CoV-2-probe FAM-TTGCTGCTGCTTGACA GATT-TAMRA-3′ |
Song, 2020 #37 | N/A |
SARS-CoV-2-S- forward primer: 5′-CAATGGTTTAACAGGCACAGG-3′ | This paper | N/A |
SARS-CoV-2-S-reverse primer: 5′-CTCAAGTGTCTGTGGATCACG-3′ | This paper | N/A |
Recombinant DNA | ||
pET21-AP205 | This paper | N/A |
pET21-AP205-SpyTag | This paper | N/A |
pCEP4-RBD | This paper | N/A |
pCEP4-RBD-SpyCatcher | This paper | N/A |
pCEP4-RBD-AviTag | This paper | N/A |
pGEX-BirA | This paper | N/A |
pcDNA3.1-SARS-Cov-2 S | Ju, 2020 #22 | N/A |
Software and algorithms | ||
FlowJo software Version 10.7.1 | Tree Star | https://www.flowjo.com/ |
GraphPad Prism 8.0 | GraphPad Software | https://www.graphpad.com/ |