. 2021 Sep 22;10(10):1976. doi: 10.3390/plants10101976

Table 1.

Primer sequences used for the amplification of housekeeping and candidate genes studied in the multi-factorial system Pinus radiata-Fusarium circinatum-Phytophthora species.

Gene	Primer Sequence	GenBank ID	Functions/Putative Functions	References
Chitinase (PR3)	F: TGGCAACACGGACGCCCATT	HM219849.1	Hydrolyzation of chitin.	[45,50,73,74]
Chitinase (PR3)	R: ACCGGCGTCGTTTCTGTGCTT	HM219849.1	Hydrolyzation of chitin.	[45,50,73,74]
Thaumatin-like protein (PR5)	F: AGGAGCGCGTGTGATGCGTT	JQ015859.1	Involved in cell wall damage and formation of pores on the plasma membrane.	[45,46,47,48,49,50,75,76]
Thaumatin-like protein (PR5)	R: TGAAAGTGCTGGTGGCGTCGT	JQ015859.1		[45,46,47,48,49,50,75,76]
Phenylalanine ammonia-lyase (PAL)	F: TGCTGGCCACTGTGAAGCAGA	AY641535.1	Lignin and phenolic accumulation in plants. Cinnamic acid synthesis	[45,46,47,48,49,50,77,78]
Phenylalanine ammonia-lyase (PAL)	R: TCGCAGAAACGGCCTGGCAA	AY641535.1		[45,46,47,48,49,50,77,78]
Pyruvate decarboxylase (PDC)	F: CCCGCAAACAATGACGTGGGGT	JQ264496.1	Involved in aerobic fermentation.	[45,46,47,48,49,50,79,80]
Pyruvate decarboxylase (PDC)	R: TGCGAGCAGATGGTCCAGCA	JQ264496.1	Involved in aerobic fermentation.	[45,46,47,48,49,50,79,80]
Actin (ACT)	F: TGGACCTTGCTGGGCGTGATCT	GQ339779.1	Major component of cytoskeleton microfilaments.	[45,46,47,48,49,50,81]
Actin (ACT)	R: ACAATCTCGCGCTCTGCGGT	GQ339779.1	Major component of cytoskeleton microfilaments.	[45,46,47,48,49,50,81]
β-Tubulin (TUB)	F: AAGGGGGTCAGTGTGGCAACCA	KM496536.1	Structural units of the cytoskeleton microtubes	[45,46,47,48,49,50,82]
β-Tubulin (TUB)	R: ACAGCCCGCGGAACAAACCT	KM496536.1	Structural units of the cytoskeleton microtubes	[45,46,47,48,49,50,82]
Ubiquitin (UBQ)	F: AGCCCTTATGCCGGAGGGGTTT	AF461687.1	Participates in protein recognition by the proteasome	[45,47,50]
Ubiquitin (UBQ)	R: AGTGCGGGACTCCACTGTTCCT	AF461687.1	Participates in protein recognition by the proteasome	[45,47,50]