TABLE 2.
Oligonucleotide primers used in the RT-PCR assay
| Primer | Sequence (5′ to 3′) | Positiona | Orientation | Reference or source |
|---|---|---|---|---|
| NF1287 | GTGTCAGAAATAGCATCCAAG | 1287–1307 | Sense | 35 |
| p2 | GTGGGATCCAGACTGGTCTTGAATAT | 1705–1680 | Antisence | 35 |
| CDV H13 | CAAGACAAGGTGGGTGCCTT | 7091–7110 | Sense | 20 |
| CDV H18 | CTTGGTGAAATCGAACTCCA | 7265–7246 | Antisence | 20 |
| RH-3 | AGGGCTCAGGTACTCCAGC | 7059–7077 | Sense | 18 |
| RH-4 | AATGCTAGAGATGGTTTAATT | 8995–8975 | Antisence | 18 |
| CDV-F8 | GTTGTTGCTGATTTACTGTT | 6800–6819 | Sense | Present study |
| CDV-R8 | CCCCGTCTGTTATTTTGCTA | 9399–9380 | Antisence | Present study |
Numerical position on the genome of CDV Onderstepoort.