KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Purified antibodies conjugated to metal isotopes, see Tables S3, S4, and S7 | Various | Various |
| BV421 mouse anti-human CD9 (clone M-L13) | BD Biosciences | Cat#743047; RRID: AB_2741243 |
| PE mouse anti-human CD9 (clone M-L13) | BD Biosciences | Cat#555372; RRID: AB_395774 |
| APC anti-human CD45 (clone HI30) | BioLegend | Cat#304037; RRID: AB_2562049 |
| Anti-PE-165Ho (clone PE001) | Fluidigm | Cat#3165015B; RRID: AB_2714168 |
| Purified anti-human CD11c (3.9) | BioLegend | Cat#301601: RRID: AB_314171 |
| Anti-human CD14 (M5E2)-160Gd | Fluidigm | Cat#3160001B; RRID: AB_2687634 |
| Anti-human CD19 (HIB19)-169TM | Fluidigm | Cat#3169011B; RRID; AB_2893034 |
| Mouse IgG1 kappa (clone 15–6E10A7) | abcam | Cat#ab170190; RRID: AB_2736870 |
| Mouse anti-CD9 antibody (clone MEM-61) | abcam | Cat#ab2215; RRID: AB_302894 |
| Biological samples | ||
| Newly diagnosed chemo naive HGSC tumors prepared as single cell suspensions, see Table S1 | Indivumed | https://www.indivumed.com/ |
| Archival FFPE HGSC tumor samples | Stanford Pathology | https://med.stanford.edu/pathology.html |
| Peripheral blood mononuclear cells (PBMCs) | Stanford Blood Center | https://stanfordbloodcenter.org/ |
| Chemicals, peptides, and recombinant proteins | ||
| Sodium heparin | Sigma-Aldrich | Cat#2106-15VL |
| Benzonase | Sigma-Aldrich | Car#E8263-25KU |
| Antibody stabilization solution | Candor Bioscience | Cat#131050 |
| Live/Dead Fixable Near-IR Dead Cell Stain Kit, for 633 or 635 nm excitation | Thermo Fisher Scientific | Cat#L10119 |
| Human TruStain FcX (FC Receptor blocking solution) | BioLegend | Cat#422302 |
| eBioscience Permeabilization Buffer (10X) | Thermo Fisher Scientific | Cat#00-8333-56 |
| Cell-ID intercalator-Ir | Fluidigm | Cat#201192B |
| Cell-ID intercalator-103Rh-2000 μM | Fluidigm | Cat#201103B |
| Palladium isotopes as nitrate salts | Trace Sciences International | N/A |
| Calibration Beads, EQ Four Element | Fluidigm | Cat#201078 |
| 16% Paraformaldehyde aqueous solution | Electron Microscopy Sciences | Cat#15711 |
| 32% Paraformaldehyde aqueous solution | Electron Microscopy Sciences | Cat#15714 |
| HistoGel | Thermo Fisher Scientific | Cat#HG-4000–012 |
| Cisplatin | Sigma-Aldrich | Cat#P4394 |
| Carboplatin | Sigma-Aldrich | Cat#2538 |
| eBioscience Cell Stimulation Cocktail (500x) | Thermo Fisher Scientific | Cat#00-4970-93 |
| eBioscience Brefeldin A solution (1000X) | Thermo Fisher Scientific | Cat#00-4506-51 |
| eBioscience Monensin solution (1000X) | Thermo Fisher Scientific | Cat#00-4505-51 |
| PKH67 Green Fluorescent Cell Linker Mini Kit for General Cell Membrane Labeling | Sigma Aldrich | Cat#MINI67–1KT |
| DAPI solution | BD Biosciences | Cat#564907 |
| PKH26 Red Fluorescent Cell Linker Mini Kit for General Cell Membrane Labeling | Sigma-Aldrich | Cat#MINI26–1KT |
| Cytochalasin D | Sigma-Aldrich | Cat#C2618 |
| Calcein-AM | Thermo Fisher Scientific | Cat#C3100MP |
| Triton X-100 | Sigma-Aldrich | Cat#T8787 |
| Critical commercial assays | ||
| QIAamp DNA Mini Kit | QIAGEN | Cat#51304 |
| GeneRead DNaseq Targeted Ovarian V2 panel | QIAGEN | Custom |
| MaxPar conjugation kit | Fluidigm | N/A |
| RNAscope 2.5 HD assay-brown kit with Hs-Nectin4 probe | ACD bio | N/A |
| Corning 96 well TC-treated microplates | Thermo Fisher Scientific | Cat#3799 |
| Corning 96 well black polystyrene microplate | Thermo Fisher Scientific | Cat#3603 |
| Corning HTS Transwell −96 Permeable Support System | Thermo Fisher Scientific | Cat#09-761-80 |
| miRNeasy isolation kit | QIAGEN | Cat#74004 |
| High-Capacity cDNA Reverse Transcription kit | Applied Biosystems, ThermoFisher Scientific | Cat#4368814 |
| TaqMan gene expression assay:
Hs00170423_m1 (CDH1-FAM) |
Applied Biosystems, ThermoFisher Scientific | Cat#4453320 |
| TaqMan gene expression assay:
Hs00894716_m1 (PTPRC-FAM) |
Applied Biosystems, ThermoFisher Scientific | Cat#4448892 |
| TaqMan gene expression assay:
Hs01124022_m1 (CD9-FAM) |
Applied Biosystems, ThermoFisher Scientific | Cat#4453320 |
| TaqMan gene expression assay:
Hs02758991_g1 (GADPH-VIC) |
Applied Biosystems, ThermoFisher Scientific | Cat#4448489 |
| TaqMan Gene Expression Master Mix | Applied Biosystems, Thermo Fisher Scientific | Cat#4370048 |
| Gene Knockout kit V2 targeting CD9 | Synthego | N/A |
| CAS9 2NLS Nuclease | Synthego | N/A |
| SE. Cell Line 4D-Nucleofector X Kit S | Lonza | Cat#V4XC-1032 |
| Taq PCR Master Mix kit | QIAGEN | Cat#201443 |
| QIAquick PCR purification kit | QIAGEN | Cat#28104 |
| Deposited data | ||
| CyTOF datasets of NK and T cell infiltrate and tumor cells for ovarian tumors | Mendeley Data | https://dx.doi.org/10.17632/mtbgnz7yk5.1 |
| Experimental models: Cell lines | ||
| OVCAR4 | Fox Chase Cancer Center | N/A |
| Kuramochi | JCRB Cell Bank | JCRB0098 |
| TYK-nu | JCRB Cell Bank | JCRB0234.0 |
| NK-92 | ATCC | CRL-2407 |
| PC3 | Brooks Lab, Stanford | N/A |
| SNU-349 | Fan Lab, Stanford | N/A |
| K562 | ATCC | CCL-243 |
| HeLa | ATCC | CCL-2 |
| A431 | ATCC | CRL-1555 |
| NCI-H28 | ATCC | CRL-5820 |
| HEPG2 | ATCC | HB-8065 |
| HCT116 | ATCC | CCL-247 |
| MCF7 | ATCC | HTB-22 |
| MCF10A | ATCC | CRL-10317 |
| CaCo-2 | ATCC | HTB-37 |
| OVCAR3 | ATCC | HTB-161 |
| HCC1937 | ATCC | CRL-2336 |
| LoVo | ATCC | CCL-229 |
| A549 | ATCC | CCL-185 |
| OVSAHO | JCRB Cell Bank | JCRB1046 |
| OVKATE | JCRB Cell Bank | JCRB1044 |
| SNU-119 | Seoul National University - Korea | N/A |
| JHOS-2 | RIKEN BRC Cell Bank | RBRC-RCB1521 |
| JHOM-2B | RIKEN BRC Cell Bank | RBRC-RCB1682 |
| COV362 | Public Health England | 7071910 |
| DLD-1 | Horizon Discovery | HD PAR-008 |
| COV318 | Sigma Aldrich | 7071903 |
| NKL | Chen Lab, Institute of Biomedical Science (Taiwan) | N/A |
| Oligonucleotides | ||
| CD9 multi-guide RNA
probe1: GCGACAUACCGCAUAGUGGA |
Synthego | N/A |
| CD9 multi-guide RNA
probe2: CUUGGUUUUCAGCUUGUUGU |
Synthego | N/A |
| CD9 multi-guide RNA
probe3: CUGCCCAUUGUAGGUGAUUA |
Synthego | N/A |
| Primer: CD9
Forward GAGCCAAGTTAGGAGCCAAGT |
Integrated DNA Technologies (IDT) | Custom |
| Primer: CD9
Reverse CGAGTACGTCCTTCTTGGGG |
Integrated DNA Technologies (IDT) | Custom |
| Primer: CD9 DNA
sequencing CCTGAGAGAAGGCAGTGCTA |
Integrated DNA Technologies (IDT) | Custom |
| Software and algorithms | ||
| CellEngine analysis software | CellCarta | https://cellengine.com/#/ |
| Vortex | Samusik et al., 2016 | https://github.com/nolanlab/vortex/ |
| Prism | GraphPad Software | https://www.graphpad.com/scientific-software/prism/, Version 9 |
| Inference of CRIPSR Edits (ICE) | Synthego (Hsiau et al., 2019) | https://ice.synthego.com/ |
| MATLAB - Normalizer | (Finck et al., 2013) | https://github.com/nolanlab/bead-normalization/wiki/Normalizing-FCS-Files |
| MATLAB – Single Cell Debarcoder | (Zunder et al., 2015) | https://github.com/nolanlab/single-celldebarcoder |
| R environment | R-project | https://www.r-project.org |
| Premessa R package | (Zunder et al., 2015) | https://github.com/ParkerICI/premessa |
| Cytobank | (Kotecha et al., 2010) | https://cytobank.org/ |
| Microsoft excel | Microsoft | https://www.microsoft.com/en-us/microsoft-365/excel |
| FlowJo | BD Biosciences | https://www.flowjo.com/ |
| Other | ||
| CyTOF2 mass cytometer | Fluidigm | N/A |
| Sony SH800 cell sorter | Sony Biotechnology | N/A |
| 7900HT Fast Real-Time PCR System | Stanford Genomics | N/A |
| Keyence BZ-X800 microscope | Keyence | N/A |
| BD LSRII flow cytometer | BD Biosciences | N/A |
| 4D-Nucleofector unit | Lonza | N/A |
| ABI 3130xl sequencer | Stanford Protein and Nucleic Acid Facility | N/A |
| Tecan Infinite M1000 microplate reader | Stanford High-Throughput Bioscience Center | N/A |