KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse anti-hs_CDH1 | BD | Cat # 610181 |
| Goat anti-dr_Tfap2a | LifeSpan Biosciences | Cat # LS-C87212 |
| Rabbit anti-dr_Tfap2e | Fisher | Cat # PA5-72631 |
| Rabbit anti-hs_TFAP2A | Cell Signaling | Cat # 3215 |
| Rabbit anti-hs_cyclophilin B | Fisher | Cat # PA1-027A |
| Anti-mouse Alexa Fluor® 488 | Cell Signaling | Cat # 4408S |
| Anti-rabbit Alexa Fluor® 594 | Cell Signaling | Cat # 8889S |
| Mouse anti-hs_H3 | Cell Signaling | Cat # 14269 |
| Rabbit anti-TFAP2A | Abcam | Cat # ab108311 |
| Rabbit anti-Sox9 | Sigma | Cat # HPA001758 |
| Mouse anti-TFAP2A | Santa Cruz Biotechnology | Cat # sc-12726 |
| Rat anti-CD45 | ThermoFisher | Cat # MA5-17687 |
| Donkey anti-mouse AF488 | ThermoFisher | Cat # A21202 |
| Donkey anti-rabbit AF647 | ThermoFisher | Cat # A31573 |
| Donkey anti-rat DyLight 555 | ThermoFisher | Cat # SA5-10027 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Human metastatic melanoma patient blood samples | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Tricaine-S | Syndel | Cat # MS-222 |
| Hoechst 33342 | Fisher | Cat # H1399 |
| poly-D-lysine | Sigma | Cat # P-0899 |
| Rabbit IgG | Millipore | Cat # 12-370 |
| Concanavalin A-coated magnetic beads | Bang Laboratories, Inc | Cat # BP531 |
| pA-MNase | Dr. Steve Henikoff | N/A |
| Liberase TL | Sigma | Cat # 5401020001 |
| Alt-R® S.p. Cas9 Nuclease V3 | Integrated DNA Technologies | Cat # 1081059 |
| Alt-R® CRISPR-Cas9 tracrRNA, ATTO™ 550 | Integrated DNA Technologies | Cat # 1075928 |
| Cas9 Electroporation Enhancer | Integrated DNA Technologies | Cat # 1075916 |
| Alt-R® CRISPR-Cas9 crRNA (see Oligonucleotides below for sequences) | Integrated DNA Technologies | N/A |
| Neon Transfection System 100 μL Kit | Fisher | Cat # MPK10025 |
| Critical commercial assays | ||
| Neon Transfection System | Fisher | Cat # MPK5000 |
| Ultra-Low Attachment Surface 96-well plate, flat well | Corning | Cat # 3474 |
| Ultra-Low Attachment Surface 96-well plate, round well | Corning | Cat # 7007 |
| Transwell assay: 3.0μm pore insert / 24-well plate | Corning | Cat # 353492 / 353504 |
| CellTiter-Glo® Luminescent Cell Viability Assay | Promega | Cat # G7572 |
| Caspase-Glo® 3/7 Assay System | Promega | Cat # G8091 |
| RNeasy Plus Mini kit | Qiagen | Cat # 74034 |
| QiaShredder | Qiagen | Cat # 79656 |
| Parsortix Cell Separation Cassette | ANGLE (Xu et al., 2015) | Cat # GEN3D6.5 |
| Chromium Single Cell 3’ Library & Gel Bead Kit v3.1 | 10X Genomics | Cat # 1000128 |
| Chromium Single Cell 3’ Chip G | 10X Genomics | Cat # 1000127 |
| Deposited data | ||
| Bulk and single-cell RNA-seq data | This paper | GEO # GSE151679 |
| TFAP2A CUT&RUN data | This paper | GEO # GSE153020 |
| Cancer Cell Line Encyclopedia (CCLE) RNA-seq | Broad CCLE (https://portals.broadinstitute.org/ccle) | RSEM genes TPM, version 20180929 |
| The Cancer Genome Atlas (TCGA) Skin Cutaneous Melanoma (SKCM) mRNA expression | Broad GDAC Firehose (http://firebrowse.org/) | v2 RSEM genes normalized, version 2016_01_28 |
| Human melanoma single-cell RNA-seq | (Jerby-Arnon et al., 2018) | GEO # GSE115978 |
| Broad Institute Dependency Map (DepMap) | Broad Institute (https://depmap.org/portal/) | CRISPR (Avana) Public 19Q3 dataset |
| AVAST-M melanoma cohort | (Corrie et al., 2018; Garg et al., 2021) | EGA # EGAD00001006401 |
| Leeds Melanoma Cohort | (Nsengimana et al., 2018) | EGA # EGAS00001002922 |
| Experimental models: Cell lines | ||
| ZMEL1-PRO (mitfa: EGFP) | This paper | N/A |
| ZMEL1-PRO (mitfa: tdTomato) | This paper | N/A |
| ZMEL1-PRO (mitfa: EGFP & Ub: nls-mCherry) | This paper | N/A |
| ZMEL1-INV (mitfa: EGFP) | This paper | N/A |
| ZMEL1-INV (mitfa: tdTomato) | This paper | N/A |
| ZMEL1-INV (mitfa: EGFP & Ub: nls-mCherry) | This paper | N/A |
| MEWO | ATCC | Cat # HTB-65 |
| SH4 | ATCC | Cat # CRL-7724 |
| SKMEL28 | ATCC | Cat # HTB-72 |
| A375 | ATCC | Cat # CRL-1619 |
| HS294T | ATCC | Cat # HTB-140 |
| A2058 | ATCC | Cat # CRL-11147 |
| RPMI7951 | ATCC | Cat # HTB-66 |
| HMCB | ATCC | Cat # CRL-9607 |
| HS895T | ATCC | Cat # CRL-7637 |
| M000921 | (Raaijmakers et al., 2015) | N/A |
| M111031 | (Raaijmakers et al., 2015) | N/A |
| M990922 | (Raaijmakers et al., 2015) | N/A |
| MM121224 | (Raaijmakers et al., 2015) | N/A |
| Experimental models: Organisms/strains | ||
| Casper zebrafish | White Lab | N/A |
| Casper;kdrl-RFP zebrafish | This paper | N/A |
| Oligonucleotides | ||
| sg_scr Alt-R crRNA | (Wang, T., et al., Science, 2015) | AACCTACGGGCTACGATACG |
| sg_cdh1_1 Alt-R crRNA | This paper | AGTGGCAAAAGACTAGGCAA |
| sg_cdh1_2 Alt-R crRNA | This paper | TCATGCAAACGGAGTGGACG |
| sg_tfap2a_1 Alt-R crRNA | This paper | TTGTGGACGTGAATTCCCCA |
| sg_tfap2a_2 Alt-R crRNA | This paper | CATGTATTCAGCTATCGCCT |
| sg_tfap2a_3 Alt-R crRNA | This paper | ATAGTTGATGCGGTAACCCG |
| sg_tfap2a_4 Alt-R crRNA | This paper | CTCAACCACAACACCCGGGA |
| sg_tfap2e_1 Alt-R crRNA | This paper | GGCAGGGGTCCCGAATCCGT |
| sg_tfap2e_2 Alt-R crRNA | This paper | TACTCCCAGAGCCAGGACGG |
| sg_tfap2e_3 Alt-R crRNA | This paper | TGAGACTGAGTTCCCTGCGC |
| sg_tfap2e_4 Alt-R crRNA | This paper | TGCACCGCGTGCATCCCCAG |
| Recombinant DNA | ||
| Ub: nls-mCherry | This paper | N/A |
| Mitfa: tdTomato | This paper | N/A |
| Software and algorithms | ||
| Zebrafish image analysis pipeline | (Heilmann et al., 2015) | https://github.com/SiljaHeilmann/Matlab-fish-image-analysis |
| Volocity v6.3 | PerkinElmer | https://www.perkinelmer.com |
| ImageJ | NIH | https://imagej.nih.gov/ij/ |
| IDL tracking methods | John Crocker, David Grier, and Eric Weeks | http://site.physics.georgetown.edu/matlab/ |
| FASTQC | Babraham Bioinformatics | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| TRIMMOMATIC | (Bolger et al., 2014) | http://www.usadellab.org/cms/?page=trimmomatic |
| STAR | (Dobin et al., 2013) | https://github.com/alexdobin/STAR |
| SeQC | (DeLuca et al., 2012) | https://bioconductor.org/packages/release/data/experiment/html/seqc.html |
| DESeq2 | (Love et al., 2014) | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| GSAA | (Xiong et al., 2012; Xiong et al., 2014) | http://gsaa.unc.edu/ |
| DIOPT | (Hu et al., 2011) | https://www.flyrnai.org/diopt |
| HOMER | (Heinz et al., 2010) | http://homer.ucsd.edu/homer |
| JASPAR | (Khan et al., 2017) | http://jaspar.genereg.net |
| Trim Galore version 0.6.3 | Developed by Felix Krueger at the Babraham Institute | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore |
| Bowtie2 version 2.1.0 | (Langmead and Salzberg, 2012) | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| ChIPseeker version 1.18.0 | (Yu et al., 2015) | https://bioconductor.org/packages/release/bioc/html/ChIPseeker.html |
| CellRanger version 3.1.0 | 10X Genomics | https://www.10xgenomics.com/ |
| Seurat version 3.1.4 | (Stuart et al., 2019) | https://satijalab.org/seurat/index.html |
| CellPhoneDB | (Efremova et al., 2020) | N/A |
| MATLAB | Mathworks | https://www.mathworks.com/products/matlab.html |
| R | R Foundation for Statistical Computing | https://www.r-project.org/ |
| Zen | Zeiss | https://www.zeiss.com |
| STATA v14 | StataCorp | https://www.stata.com/stata14/ |
| Other | ||