Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Includes the reference information for the genes used in the detailed qPCR analyses.
| Primer | Sequence |
|---|---|
| uPA (PLAUR) | Bio-Rad Prime PCR Probe Assay: Cy5 Fluorophore, qHsaCIP0031103 |
| uPA (PLAU) | Bio-Rad Prime PCR Probe Assay: Cy5.5 Fluorophore, qHsaCIP0032518 |
| LRP1 |
ACATATAGCCTCCATCCTAATC GCTTATACCAGAATACCACTC |
| α-SMA (ACTA2) | Bio-Rad Prime PCR Probe Assay: FAM Fluorophore, qHsaCIP0028813 |
| GUSB | Bio-Rad Prime PCR Probe Assay: HEX Fluorophore, qHsaCIP0028142 |
