Table 2.
Includes the reference information for the genes used in the detailed qPCR analyses.
Primer | Sequence |
---|---|
uPA (PLAUR) | Bio-Rad Prime PCR Probe Assay: Cy5 Fluorophore, qHsaCIP0031103 |
uPA (PLAU) | Bio-Rad Prime PCR Probe Assay: Cy5.5 Fluorophore, qHsaCIP0032518 |
LRP1 |
ACATATAGCCTCCATCCTAATC GCTTATACCAGAATACCACTC |
α-SMA (ACTA2) | Bio-Rad Prime PCR Probe Assay: FAM Fluorophore, qHsaCIP0028813 |
GUSB | Bio-Rad Prime PCR Probe Assay: HEX Fluorophore, qHsaCIP0028142 |