TABLE 2.
Strains, plasmids, and primers used in this study
| Strain or plasmid | Relevant characteristics or sequence (5′→3′)a | Source or Reference |
|---|---|---|
| Strains | ||
| E. coli | ||
| TOP10 | General cloning and blue/white screening | Life Technologies |
| E. cloni 10G | General cloning and blue/white screening | Lucigen |
| S17-1 | Mobilizing strain with transfer genes of RP4 integrated on chromosome, Smr, Tpr | 66 |
| INV110 | dam and dcm deficiencies to allow restriction digestion with Dam- and Dcm-sensitive restriction enzymes | Invitrogen |
| B. pseudomallei | ||
| 1026b | Isolated in Thailand from a human case of septicemic melioidosis with skin, soft tissue, and spleen involvement, Pmr | 59 |
| Bp82 | 1026b ΔpurM derivative; adenine and thiamine auxotroph | 60 |
| SMM1 | Bp82 derivative, hmqA::TnMod-OKm′ | This study |
| SMM2 | Bp82 derivative, hmqD::TnMod-OKm′ | This study |
| Bp82 ΔhmqA | Bp82 derivative harboring a 438-bp in-frame deletion mutation in hmqA (ΔhmqA) | This study |
| Bp82 ΔhmqD | Bp82 derivative harboring a 318-bp in-frame deletion mutation in hmqD (ΔhmqD) | This study |
| Bp82 ΔhmqF | Bp82 derivative harboring a 948-bp in-frame deletion mutation in hmqF (ΔhmqF) | This study |
| K96243 | Isolated in Thailand from a diabetic patient with a clinical history of short incubation, septicemic infection, and rapid progression to death | 58 |
| MSHR346 | Isolated in 1995 from the sputum of a melioidosis patient admitted to Royal Darwin Hospital, Northern Territory, Australia | P. Keim |
| Plasmids | ||
| pCR2.1-TOPO | 3,931-bp TA vector, pMB1 oriR, Kmr, Apr | Life Technologies |
| pCR2.1-hmqA | pCR2.1-TOPO containing 1,639-bp PCR product generated with hmqA-up and hmqA-dn | This study |
| pCR2.1-ΔhmqA | pCR2.1-hmqA digested with MluI and religated resulting in a 438-bp in-frame deletion in hmqA | This study |
| pCR2.1-hmqD | pCR2.1-TOPO containing 1,142-bp PCR product generated with hmqD-up and hmqD-dn | This study |
| pCR2.1-ΔhmqD | pCR2.1-hmqD digested with ClaI and religated resulting in a 318-bp in-frame deletion in hmqD | This study |
| pCR2.1-hmqF | pCR2.1-TOPO containing 1,995-bp PCR product generated with hmqF-up and hmqF-dn | This study |
| pTnMod-OKm′ | Minitransposon vector, pMB1 oriR, RP4 oriT, Tn5 tnp, Kmr | 39 |
| pSMM1No | Plasmid obtained from SMM1 by in vitro cloning with NotI | This study |
| pSMM2No | Plasmid obtained from SMM2 by in vitro cloning with NotI | This study |
| pMo130 | Suicide vector for allelic exchange in Burkholderia, ColE1 ori, RK2 oriT xylE sacB, Kmr | 62 |
| pMo130-ΔhmqA | pMo130 containing the NheI insert from pCR2.1-ΔhmqA | This study |
| pMo130-ΔhmqD | pMo130 containing the SpeI-XbaI insert from pCR2.1-ΔhmqD cloned into the NheI site | This study |
| pMo130-hmqF | pMo130 containing the SpeI-XbaI insert from pCR2.1-hmqF cloned into the NheI site | This study |
| pMo130-ΔhmqF | pMo130-hmqF digested with BclI and religated resulting in a 948-bp in-frame deletion in hmqF | This study |
| pBHR2 | Broad-host-range plasmid, Kmr | 19 |
| pBHR2-hmqA | pBHR2 containing EcoRI insert from pCR2.1-hmqA, constitutively expresses hmqA | This study |
| pBHR2-hmqD | pBHR2 containing EcoRI insert from pCR2.1-hmqD, constitutively expresses hmqD | This study |
| pBHR2-hmqF | pBHR2 containing EcoRI insert from pCR2.1-hmqF, constitutively expresses hmqF | This study |
| Primers | ||
| 553F | GTGCCAGCAGCCGCGGTAA | 35 |
| 1492R | ACCTTGTTACGACTT | 36 |
| Rd1 | AAGGAGGTGATCCAGCC | 67 |
| Fd1 | AGTTTGATCCTGGCTCAG | 67 |
| M13 Forward | GTAAAACGACGGCCAG | Life Technologies |
| M13 Reverse | CAGGAAACAGCTATGAC | Life Technologies |
| TnMod-LT2 | TTCCTGGTACCGTCGACATG | This study |
| hmqA-up | GCTAGCGTGAGCACTGACGATGGAC | This study |
| hmqA-dn | GCTAGCTCAGGCCGCCTGCACGTCTTC | This study |
| hmqD-up | TCGCCGCGGCGTCGTGAAGC | This study |
| hmqD-dn | TCAGCTTCGATAGAGCGCGC | This study |
| hmqF-up | ACGAACAACTCGCGACGCTC | This study |
| hmqF-dn | ACTCCGAGCCGAGGATCTTC | This study |
a
r, resistant; s, susceptible; Sm, streptomycin; Tp, trimethoprim; Pm, polymyxin B; Km, kanamycin; Ap, ampicillin.