Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Zc3h12a | NA | Gene ID: 230738 | |
| Gene (Homo sapiens) | ZC3H12A | NA | Gene ID: 80149 | |
| Strain, strain background (Mus musculus) | Zc3h12a WT/WT | CLEA Japan | C57BL/6 | C57BL/6JJcl |
| Strain, strain background (Mus musculus) | Zc3h12a -/- | https://doi.org/10.1038/nature07924 | ||
| Strain, strain background (Mus musculus) | Zc3h12a S513A/S513A | this paper | generated using CRISPR-Cas9 system | |
| Sequence-based reagent | DNA oligo (for pX330) | this paper | CACCGCGGCTCAGACCAGTACTCTC | for Zc3h12aS513A/S513A generation |
| Sequence-based reagent | DNA oligo (for pX330) | this paper | AAACGAGAGTACTGGTCTGAGCCGC | for Zc3h12aS513A/S513A generation |
| Sequence-based reagent | Donor single strand oligo | this paper | GAAGGACAGGAGTGGGTGGGGGTAATGGGTACGGCTCAGCCCAGTACTCTCTGGATGGGTAGGTGGGTGGCGGGGGCACA | for Zc3h12aS513A/S513A generation |
| Sequence-based reagent | DNA oligo (for pX459-IRAK1KO) | https://doi.org/10.1093/bioinformatics/btu743 | CACCGGTCTGGTCGCGCACGATCA | |
| Sequence-based reagent | DNA oligo (for pX459-IRAK1KO) | https://doi.org/10.1093/bioinformatics/btu743 | AAACTGATCGTGCGCGACCAGACC | |
| Sequence-based reagent | DNA oligo (for pX459-IRAK2KO) | https://doi.org/10.1038/nbt.3437 | CACCGAAAACCGCAAAATCAGCCAG | |
| Sequence-based reagent | DNA oligo (for pX459-IRAK2KO) | https://doi.org/10.1038/nbt.3437 | AAACCTGGCTGATTTTGCGGTTTTC | |
| Antibody | Anti-mouse-Regnase-1 (rabbit polyclonal) |
MBL life science | custom antibody production (1:1000) |
|
| Antibody | Anti-human-Regnase-1 (rabbit polyclonal) |
Atlas Antibodies | Cat # HPA032053 | (1:500) |
| Antibody | Anti-14-3-3 (pan) (mouse monoclonal) |
Santa Cruz Biotechnology | Cat # sc-1657 | (1:1000) |
| Antibody | Anti-IκB-α (rabbit polyclonal) |
Santa Cruz Biotechnology | Cat # sc-371 | (1:1000) |
| Antibody | Anti-IRAK1 (mouse monoclonal) |
Santa Cruz Biotechnology | Cat # sc-5288 | (1:500) |
| Antibody | Anti-FLAG (mouse monoclonal) |
Sigma | Cat # F3165 | (WB:1:2000, IF:1:5000) |
| Antibody | Anti-FLAG (rabbit polyclonal) |
Sigma | Cat # F7425 | (1:2000) |
| Antibody | Anti-HA (mouse monoclonal) |
Sigma | Cat # H3663 | (1:2000) |
| Antibody | Anti-HA (rabbit polyclonal) |
Sigma | Cat # H6908 | (1:2000) |
| Antibody | Anit-Myc (mouse monoclonal) |
Sigma | Cat # M4439 | (1:2000) |
| Antibody | Anti-Myc (rabbit polyclonal) |
Sigma | Cat # C3956 | (1:2000) |
| Antibody | Anti-β-Actin-HRP (mouse monoclonal) |
Santa Cruz Biotechnology | Cat # sc-47778-HRP | (1:2000) |
| Antibody | Anti-Mouse IgG-HRP F(ab')2 (sheep polyclonal) |
cytiva | Cat # NA9310-1ML | (1:5000) |
| Antibody | Anti-Rabbit IgG-HRP F(ab')2 (donkey polyclonal) |
cytiva | Cat # NA9340-1ML | (1:5000) |
| Antibody | F(ab')2-anti-Mouse IgG (H+L)-AF488 (Goat polyclonal) |
Invitrogen | Cat # A11017 | (1:2000) |
| Recombinant DNA reagent | pX330-U6-Chimeric_BB-CBh-hSpCas9 | Addgene | RRID:Addgene_42230 | |
| Recombinant DNA reagent | pSpCas9(BB)-2A-Puro (PX459) V2.0 | Addgene | RRID:Addgene_62988 | |
| Recombinant DNA reagent | pMD2.G | Addgene | RRID:Addgene_12259 | |
| Recombinant DNA reagent | pMDLg/pRRE | Addgene | RRID:Addgene_12251 | |
| Recombinant DNA reagent | pRSV-Rev | Addgene | RRID:Addgene_12253 | |
| Recombinant DNA reagent | pInducer20 | Addgene | RRID:Addgene_44012 | |
| Recombinant DNA reagent | pInducer20-puro | this paper | NeoR of pInducer20 (Addgene_44012) was replaced with PuroR | |
| Recombinant DNA reagent | pFLAG-CMV2 | Sigma | Cat # E7033 | |
| Recombinant DNA reagent | pEGFP-C1 | Clontech | ||
| Peptide, recombinant protein | FLAG Peptide | Sigma | Cat # F3290 | |
| Peptide, recombinant protein | HA peptide | MBL Life science | Cat # 3320 | HA tagged Protein PURIFICATION KIT |
| Peptide, recombinant protein | recombinant human IL-1β | R and D Systems | Cat # 201-LB-005 | |
| Peptide, recombinant protein | recombinant mouse IL-1β | BioLegend | Cat # 575102 | |
| Peptide, recombinant protein | recombinant human IL-17A | BioLegend | Cat # 570502 | |
| Peptide, recombinant protein | recombinant human TNF | BioLegend | Cat # 570104 | |
| Commercial assay or kit | Dynabeads Protein G | Invitrogen | Cat # 10004D | |
| Commercial assay or kit | Lambda Protein Phosphatase | NEB | Cat # P0753S | |
| Commercial assay or kit | Signal Enhancer HIKARI | nacalai tesque | Cat # 02270-81 | |
| Commercial assay or kit | Immobilon Forte Western HRP Substrate | Millipore | Cat # WBLUF0500 | |
| Commercial assay or kit | TRIzol Reagent | Invitrogen | Cat # 15596018 | |
| Commercial assay or kit | RNA Clean and Concentrator-5 | Zymo Research | Cat # R1014 | |
| Commercial assay or kit | PowerUp SYBR Green Master Mix | Applied Biosystems | Cat # A25742 | |
| Commercial assay or kit | IL-6 Mouse Uncoated ELISA Kit | Invitrogen | Cat # 88-7064-88 | |
| Chemical compound, drug | DSP (dithiobis(succinimidyl propionate)) | TCI | Cat # D2473 | |
| Chemical compound, drug | Pam3CSK4 | InvivoGen | Cat # tlrl-pms | |
| Chemical compound, drug | poly I:C | cytiva | Cat # 27473201 | |
| Chemical compound, drug | LPS | InvivoGen | Cat # tlrl-smlps | |
| Chemical compound, drug | R848 | InvivoGen | Cat # tlrl-r848-5 | |
| Chemical compound, drug | CpG DNA | InvivoGen | Cat # tlrl-1668-1 | ODN 1668 |
| Chemical compound, drug | MG-132 | Sigma | Cat # 474790 | |
| Chemical compound, drug | Actinomycin D | Sigma | Cat # A9415 | |
| Chemical compound, drug | Leptomycin B | Sigma | Cat # L2913 |