Skip to main content
. 2021 Oct 19;10:e69264. doi: 10.7554/eLife.69264

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Danio rerio) AB ZIRC RRID: ZL1ZFIN ID: ZDB-GENO-960809–7
Strain, strain background (Danio rerio) Tübingen ZIRC RRID: ZIRC_ZL57ZFIN ID: ZDBGENO-990623–3
Genetic reagent (Danio rerio) lhfpl5bvo35/vo35 Erickson et al., 2019 RRID:ZIRC_ZL13656.05ZFIN ID: ZDB-GENO-200824–4
Genetic reagent (Danio rerio) TgBAC(neurod1:EGFP) Obholzer et al., 2008 ZFIN ID: ZDB-ALT-080701–1
Genetic reagent (Danio rerio) Tg(myo6b:actb1-EGFP) Kindt et al., 2012 ZFIN ID: ZDB-TGCONSTRCT-120926–1
Genetic reagent (Danio rerio) Tg(mpeg1:YFP) Roca and Ramakrishnan, 2013 ZFIN ID: ZDB-ALT-130130–3
Sequence-based reagent lhfpl5b_ F Erickson et al., 2019 PCR primer GCGTCATGTGGGCAGTTTTC; Made by IDT
Sequence-based reagent lhfpl5b_R Erickson et al., 2019 PCR primer TAGACACTAGCGGCGTTGC; Made by IDT
Antibody (Ribbon label: Mouse monoclonal anti-Ribeye b IgG2a) Sheets et al., 2011 N/A (1:10,000)
Antibody (Ribbon label: Mouse monoclonal anti-panCtBP IgG2a) Santa Cruz Cat. No. sc-55502 (1:1000)
Antibody (PSD label: Mouse monoclonal anti-panMAGUK IgG1) NeuroMab K28/86, #75–029 (1:500)
Antibody (Chicken polyclonal anti-GFP) Aves Labs Cat. No. GFP-1020 (1:500)
Antibody (Hair cell label: Rabbit polyclonal anti-Parvalbumin) Thermo Fisher Cat. No. PA1-933 (1:500)
Antibody (Hair cell label: Rabbit polyclonal anti-Parvalbumin) Abcam Cat. No. ab11427 (1:2000)
Antibody (Hair cell label: Mouse anti-Otoferlin IgG2a) Developmental Studies Hybridoma Bank HCS-1 (1:500)
Antibody (Goat anti-Rabbit IgG Secondary Antibody, Pacific Blue) Thermo Fisher Cat. No. P-10994 (1:400)
Antibody (Goat anti- Mouse IgG1 Antibody, Alexa Fluor 488) Thermo Fisher Cat. No. A-21121 (1:1000)
Antibody (Goat anti-Chicken IgY Antibody, Alexa Fluor 488) Thermo Fisher Cat. No. A-11039 (1:1000)
Antibody (Goat anti-Rabbit IgG Antibody, Dylight 549) Vector Laboratories Cat. No. DI-1549–1.5 (1:1000)
Antibody (Goat anti-Rabbit IgG Antibody, Alexa Fluor 555) Thermo Fisher Cat. No. A27039 (1:1000)
Antibody (Goat anti- Mouse IgG2a Antibody, Alexa Fluor 647) Thermo Fisher Cat. No. A-21241 (1:1000)
Peptide, recombinant protein MluCI New England Biolabs Cat. No. R0538
Chemical compound, drug DL-TBOA Tocris Cat. No.1223
Chemical compound, drug Copper(II) sulfate (CuSO4) Millipore Sigma Cat. No. 451,657
Chemical compound, drug 2.5 % Glutaraldehyde in 0.1 M Sodium Cacodylate Buffer, pH 7.4: SEM Electron Microscopy Sciences Cat. No. 15,960
Chemical compound, drug Paraformaldehyde; IHC Millipore Sigma Cat. No. 158,127
Commercial assay or kit Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 555 dye Thermo Fisher Cat. No. C10338
Software, algorithm FIJI is just ImageJ NIH https://imagej.net/software/fiji/
Software, algorithm Volocity Quorum Technologies https://quorumtechnologies.com/index.php/component/content/category/31-volocity-software
Software, algorithm Prism (v9) Graphpad Software https://www.graphpad.com/
Software, algorithm Adobe Illustrator Adobe https://www.adobe.com/
Other FM1-43X; fixable analog of FM 1–43 Thermo Fisher Cat. No. F35355 3 µM for 20 seconds
Other DAPI nuclear stain Thermo Fisher Cat. No. Cat. No. F35355 5 mg/ml stock; diluted (1:2000)