| Genetic reagent (Mus musculus) |
C57BL/6J |
Jackson Laboratory |
Stock #: 000664 RRID:IMSR_JAX:000664
|
|
| Genetic reagent (M. musculus) |
Tazflox/flox: Yapflox/flox
|
Jackson Laboratory |
Stock #: 030532RRID:IMSR_JAX:030532
|
|
| Genetic reagent (M. musculus) |
Albumin-Cre |
Jackson Laboratory |
Stock #: 003574RRID:IMSR_JAX:003574
|
|
| Genetic reagent (M. musculus) |
Tazflox/flox: Alb-Cre |
This paper |
|
See ‘Animals and treatments’ in Materials and methods |
| Cell line (Homo sapiens) |
HepG2 |
ATCC |
Cat. #: HB-8065RRID:CVCL 0027 |
|
| Cell line (H. sapiens) |
293A |
Thermo Fisher Scientific |
Cat. #: R70507RRID:CVCL_6910
|
|
| Commercial assay or kit |
BLOCK-iT U6 RNAi entry vector kit |
Thermo Fisher Scientific |
Cat. #: K494500 |
|
| Commercial assay or kit |
BLOCK-iT U6 adenoviral RNAi expression system |
Thermo Fisher Scientific |
Cat. #: K494100 |
|
| Commercial assay or kit |
Stellux Chemiluminscence rodent insulin ELISA kit |
Alpco |
Cat. #:80-INSMR-CH01 |
|
| Commercial assay or kit |
Mouse glucagon ELISA kit |
Alpco |
Cat. #:48-GLUHU-E01 |
|
| Commercial assay or kit |
Dual-luciferase reporter assay kit |
Promega |
Cat. #: E1960 |
|
| Commercial assay or kit |
VIP substrate Kit, HRP |
Vector Laboratories |
Cat. #: SK-4600 RRID:AB_2336848
|
PMID:28123024
|
| Commercial assay or kit |
Mutagenesis kit |
Agilent |
Cat. #: 210,519 |
|
| Commercial assay or kit |
cDNA synthesis kit |
Thermo Fisher Scientific |
Cat. #: 4368813 |
|
| Commercial assay or kit |
NE-PER Nuclear and Cytoplasmic Extraction kit |
Thermo Fisher Scientific |
Cat. #: 78835 |
|
| Commercial assay or kit |
Amplex glucose oxidase assay kit |
Thermo Fisher Scientific |
Cat. #: A22189 |
|
| Recombinant DNA reagent |
pCMV-TOPO TAZ (human) |
Addgene |
Cat. #: 24809 RRID:Addgene_24809
|
PMID:18568018
|
| Recombinant DNA reagent |
pcDNA3-flag-TAZ (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pcDNA3-flag-TAZ S51A (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pcDNA3-flag-TAZ S89A (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pCMV-TOPO TAZΔWW (human) |
Addgene |
Cat. #: 24811RRID:Addgene_24811
|
PMID:18568018
|
| Recombinant DNA reagent |
pCMV-TOPO TAZΔCC (human) |
Addgene |
Cat. #: 24816 RRID:Addgene_24816
|
PMID:18568018
|
| Recombinant DNA reagent |
pcDNA3-flag-TAZΔWW (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pcDNA3-flag- TAZΔCC (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pcDNA3-flag-TAZ WW |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pGL3-3XGRE-Luc |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pGL3-G6PC-Luc (human) |
Dr. Pere Puigserver |
|
|
| Recombinant DNA reagent |
pGL3-PCK1-Luc (human) |
Dr. Pere Puigserver |
|
|
| Recombinant DNA reagent |
pcDNA3-HNF4 α (mouse) |
Dr. Pere Puigserver |
|
|
| Recombinant DNA reagent |
pcDNA3-PGC1α (mouse) |
Dr. Pere Puigserver |
|
|
| Recombinant DNA reagent |
pEGFP-GR |
Addgene |
Cat. #: 47504 RRID:Addgene_47504
|
|
| Recombinant DNA reagent |
pcDNA3-GR (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pcDNA3-GR4A (human) |
This paper |
|
See ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
8xGTIIC-Luc |
Addgene |
Cat. #: 34615 RRID:Addgene_34615
|
PMID:21654799
|
| Recombinant DNA reagent |
pcDNA3-Flag-YAP1 (human) |
Addgene |
Cat. #: 18881 RRID:Addgene_18881
|
PMID:18280240
|
| Recombinant DNA reagent |
pRK5-TEAD1 (human) |
Addgene |
Cat. #: 33109 RRID:Addgene_33109
|
PMID:18579750
|
| Recombinant DNA reagent |
pAd-Track-CMV-GFP |
Addgene |
Cat. #: 16405 RRID:Addgene_16405
|
PMID:9482916Construct to establish adenovirus |
| Recombinant DNA reagent |
pAd-Track-CMV-Flag-TAZ (human) |
This paper |
|
Construct to establish adenovirus expressing TAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pAd-Track-CMV-Flag-TAZΔWW (human) |
This paper |
|
Construct to establish adenovirus expressing TAZΔWW; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
pAd-Track-CMV-Flag-TAZS89A (human) |
This paper |
|
Construct to establish adenovirus expressing TAZS89A; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
U6-shLamin (human) |
This paper |
|
Control for shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
U6-shTAZ (human) |
This paper |
|
Construct to knockdown TAZ in HepG2 cells; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
U6-shLacZ |
This paper |
|
Construct to establish adenovirus expressing shControl; control for shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
U6-shTAZ (mouse) |
This paper |
|
Construct to establish adenovirus expressing shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-shLacZ |
This paper |
|
Control adenovirus expressing shLacZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-shTAZ (mouse) |
This paper |
|
Adenovirus expressing shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-Track-CMV-GFP |
This paper |
|
Control adenovirus expressing GFP, generated from pAd-Track-CMV-GFP vector; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-Track-CMV-flag-TAZ |
This paper |
|
Adenovirus generated from pAd-Track-CMV-TAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-Track-CMV-flag-TAZΔWW |
This paper |
|
Adenovirus generated from pAd-Track-CMV-TAZΔWW; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Recombinant DNA reagent |
Ad-Track-CMV-flag-TAZS89A |
This paper |
|
Adenovirus generated from pAd-Track-CMV-TAZS89A; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods |
| Sequence-based reagent |
shLamin (human) |
This paper |
|
CTGGACTTCCAGAAGAACA |
| Sequence-based reagent |
shLacZ |
This paper |
|
CTACACAAATCAGCGATTT |
| Sequence-based reagent |
shTAZ (human) |
This paper |
|
GCTCAGATCCTTTCCTCAATG |
| Sequence-based reagent |
shTAZ (mouse) |
This paper |
|
GCCAGAGATACTTCCTTAATC |
| Sequence-based reagent |
Mouse-Tbp-F |
This paper |
qRT-PCR primer |
ACCTTCACCAATGACTCCTATG |
| Sequence-based reagent |
Mouse-Tbp-R |
This paper |
qRT-PCR primer |
TGACTGCAGCAAATCGCTTGG |
| Sequence-based reagent |
Mouse-Cry61-F |
This paper |
qRT-PCR primer |
CAAGAAATGCAGCAAGACCA |
| Sequence-based reagent |
Mouse-Cry61-R |
This paper |
qRT-PCR primer |
GGCCGGTATTTCTTGACACT |
| Sequence-based reagent |
Mouse-Ctgf-F |
This paper |
qRT-PCR primer |
TCCACCCGAGTTACCAATGA |
| Sequence-based reagent |
Mouse-Ctgf -R |
This paper |
qRT-PCR primer |
CAAACTTGACAGGCTTGGC |
| Sequence-based reagent |
Mouse-G6pc-F |
This paper |
qRT-PCR primer |
TGGCTTTTTCTTTCCTCGAA |
| Sequence-based reagent |
Mouse-Pck1-F |
This paper |
qRT-PCR primer |
TCGGAGACTGGTTCAACCTC |
| Sequence-based reagent |
Mouse-Pck1-R |
This paper |
qRT-PCR primer |
GAGGGACAGCAGCACCAT |
| Sequence-based reagent |
Mouse-Taz-F |
This paper |
qRT-PCR primer |
ACAGGTGAAAATTCCGGTCA |
| Sequence-based reagent |
Mouse-Taz -R |
This paper |
qRT-PCR primer |
GAAGGCAGTCCAGGAAATCA |
| Sequence-based reagent |
Mouse-Yap-F |
This paper |
qRT-PCR primer |
AAGCCATGACTCAGGATGGA |
| Sequence-based reagent |
Mouse-Yap-R |
This paper |
qRT-PCR primer |
GTTCATGGCAAAACGAGGGTC |
| Sequence-based reagent |
Mouse-Ctgf-ChIP-F |
This paper |
qChIP primer |
TTCCTGGCGAGCTAAAGTGT |
| Sequence-based reagent |
Mouse-Ctgf-ChIP-R |
This paper |
qChIP primer |
CCTTCCTGCCTCATCAACTC |
| Sequence-based reagent |
Mouse-G6pc-ChIP-GRE-F |
This paper |
qChIP primer |
AGCACTGTCAAGCAGTGTGC |
| Sequence-based reagent |
Mouse-G6pc-ChIP-GRE-F |
This paper |
qChIP primer |
GCAAAACAGGCACACAAAAA |
| Sequence-based reagent |
Mouse-G6pc-ChIP-HNF4E-F |
This paper |
qChIP primer |
CCCTGAACATGTTTGCATCA |
| Sequence-based reagent |
Mouse-G6pc-ChIP-HNF4E-R |
This paper |
qChIP primer |
GTAGGTCAATCCAGCCCTGA |
| Sequence-based reagent |
Mouse-Pck1-ChIP-Con-F |
This paper |
qChIP primer |
TGGGAGACACACATCTTATTCCA |
| Sequence-based reagent |
Mouse-Pck1-ChIP-Con-R |
This paper |
qChIP primer |
GTCCCTCTATAGACTTCCAGCACA |
| Sequence-based reagent |
Mouse-Pck1-ChIP-GRE-F |
This paper |
qChIP primer |
TGCAGCCAGCAACATATGAA |
| Sequence-based reagent |
Mouse-Pck1-ChIP-GRE-F |
This paper |
qChIP primer |
TGATGCAAACTGCAGGCTCT |
| Sequence-based reagent |
Mouse-Pck1-ChIP-HNF4E-F |
This paper |
qChIP primer |
TAAGGCAAGAGCCTGCAGTT |
| Sequence-based reagent |
Mouse-Pck1-ChIP-HNF4E-F |
This paper |
qChIP primer |
AGGCCCCTCTATCAGCCATA |
| Antibody |
(Rabbit polyclonal) anti-TAZ |
Cell Signaling Technology |
Cat. #: 4883 RRID:AB_1904158
|
PMID:29533785IB (1:1000) |
| Antibody |
(Rabbit monoclonal) anti-p-TAZ (Ser89) |
Cell Signaling Technology |
Cat. #: 59971 RRID:AB_2799578
|
IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-AKT |
Cell Signaling Technology |
Cat. #: 9272 RRID:AB_329827
|
PMID:23653460IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-p-AKT (Thr308) |
Cell Signaling Technology |
Cat. #: 9275 RRID:AB_329828
|
PMID:23715867IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-p-AKT (Ser473) |
Abclonal |
Cat. #: AP0098 RRID:AB_2770899
|
IB (1:1000) |
| Antibody |
(Mouse monoclonal) anti-beta-actin |
Santa Cruz Biotechnology |
Cat. #: sc-47778 RRID:AB_2714189
|
PMID:28017329IB (1:3000) |
| Antibody |
(Rabbit monoclonal) anti-CREB |
Cell Signaling Technology |
Cat. #: 9197RRID:AB_331277
|
PMID:24080368IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-p-CREB (Ser133) |
Abclonal |
Cat. #: AP0333RRID:AB_2771008
|
IB (1:1000) |
| Antibody |
(Mouse monoclonal) anti-Flag |
Abclonal |
Cat. #: AE005RRID:AB_2770401
|
IB (1:10000)IP (1 µg/IP)ChIP (1–2 µg/IP) |
| Antibody |
(Rabbit polyclonal) anti-Flag |
Cell Signaling Technology |
Cat. #: 2368 RRID:AB_2217020
|
PMID:25514086IB (1:1000) |
| Antibody |
(Rabbit monoclonal) anti-FoxO1 |
Cell Signalling Technology |
Cat. #: 2880 RRID:AB_2106495
|
PMID:24248465IB (1:1000) |
| Antibody |
(Rabbit monoclonal) anti-p-FoxO1 (Ser256) |
Cell Signaling Technology |
Cat. #: 84192 RRID:AB_2800035
|
PMID:31583122IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-G6PC |
Abcam |
Cat. #: ab83690 RRID:AB_1860503
|
PMID:25774555IB (1:1000) |
| Antibody |
(Mouse monoclonal) anti-GAPDH |
Santa Cruz Biotechnology |
Cat. #: sc-32233 RRID:AB_627679
|
PMID:24105481IB (1:1000) |
| Antibody |
(Mouse monoclonal) anti-GLUL |
BD Biosciences |
Cat. #: 610517 RRID:AB_397879
|
PMID:17120293IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-GR |
Abclonal |
Cat. #: A2164 RRID:AB_2764182
|
IB (1:3000) |
| Antibody |
Goat polyclonal anti-HMGCR |
Santa Cruz Biotechnology |
Cat. #: sc-27578 RRID:AB_2118199
|
PMID:26824363IB (1:1000) |
| Antibody |
(Rabbit polyclonal) anti-HNF4α |
Santa Cruz Biotechnology |
Cat. #: sc-8987 RRID:AB_2116913
|
PMID:29937200IB (1:000) |
| Antibody |
(Rabbit polyclonal) anti-PGC1α |
Abclonal |
Cat. #: A12348 RRID:AB_2759191
|
IB (1:000) |
| Antibody |
(Rabbit monoclonal) anti-Tubulin |
Cell SignalingTechnology |
Cat. #: 2125 RRID:AB_2619646
|
PMID:28343940IB (1:5000) |
| Antibody |
(Mouse monoclonal) anti-Vinculin |
Santa Cruz Biotechnology |
Cat. #: sc-73614 RRID:AB_1131294
|
PMID:29017056IB (1:5000) |
| Antibody |
(Rabbit polyclonal) anti-YAP |
Cell Signaling Technology |
Cat. #: 4912 RRID:AB_2218911
|
PMID:28323616IB (1:000) |
| Antibody |
(Mouse polyclonal) anti-IRS1 |
Provided by Dr. Morris White |
|
PMID:29867232IB (1:000) |
| Antibody |
(Mouse polyclonal) anti-IRS2 |
Provided by Dr. Morris White |
|
PMID:29867232IB (1:000) |
| Antibody |
(Rabbit polyclonal) anti-Ac-Histone4 |
Abclonal |
Cat. #: A15233 RRID:AB_2762128
|
ChIP (1 µg/IP) |
| Antibody |
(Mouse monoclonal) anti-GR |
Santa Cruz Biotechnology |
Cat. #: Sc-393232 RRID:AB_2687823
|
PMID:28467930ChIP (1–2 µg/IP) |
| Antibody |
(Rabbit polyclonal) anti-TAZ |
Abclonal |
Cat. #: A8202 RRID:AB_2721146
|
ChIP (1–2 µg/IP)IHC (1: 200) |
| Antibody |
Goat anti-(Rabbit polyclonal) IgG-HPR |
Thermo Fisher Scientific |
Cat. #: 31460RRID:AB_228341
|
PMID:24932808IB (1:5000–20,000) |
| Antibody |
Goat anti-(Mouse polyclonal) IgG-HRP |
Thermo Fisher Scientific |
Cat. #: 31430RRID:AB_228307
|
PMID:10359649IB (1:5000–20,000) |
| Antibody |
Rabbit anti-goat (Rabbit polyclonal) IgG-HRP |
Santa Cruz Biotechnology |
Cat. #: sc-2768RRID:AB_656964
|
PMID:23970784IB (1:5000–15,000) |
| Chemical compound, drug |
Glucagon |
Sigma |
Cat. #: G2044 |
|
| Chemical compound, drug |
RU486 |
Sigma |
Cat. #: M8046 |
|
| Chemical compound, drug |
Dexamethasone |
Sigma |
Cat. #: D4902 |
For cell culture studies |
| Chemical compound, drug |
Dexamethasone |
Sigma |
Cat. #: 2915 |
For in vivo studies |
| Chemical compound, drug |
Sodium pyruvate |
Sigma |
Cat. #: P5280 |
|
| Chemical compound, drug |
Protease inhibitor cocktail tablet |
Sigma |
Cat. #: S8820 |
|
| Chemical compound, drug |
Phosphatase inhibitor cocktail tablet |
Sigma |
Cat. #: 4906837001 |
|
| Chemical compound, drug |
Bovine insulin |
Sigma |
Cat. #: I0516 |
For cell culture studies |
| Chemical compound, drug |
Human insulinHumulin R U-100 |
Eli Lily |
Cat. #: HI-210 |
For in vivo studies |
| Chemical compound, drug |
Percoll |
Cytiva |
Cat. #: 17089109 |
|
| Chemical compound, drug |
Trizol |
Thermo Fisher Scientific |
Cat. #: 15596018 |
|
| Chemical compound, drug |
DSP |
Thermo Fisher Scientific |
Cat. #: PG82081 |
|
| Other |
SYBR Green PCR master mix |
Bioline |
Cat. #: BIO-84050 |
|
| Other |
Collagen Type I Rat Tail |
Corning |
Cat. #: 354,236 |
|
| Other |
Collagenase Type I |
Worthington Biochemical Corporation |
Cat. #: LS004196
|
|
| Other |
PVDF membrane |
Sigma |
Cat. #: IPVH00010 |
|
| Other |
ECL |
Thermo Fisher Scientific |
Cat. #: A43841 |
|
| Other |
Agarose A/G beads |
Santa Cruz Biotechnology |
Cat. #: sc-2003 RRID:AB_10201400
|
PMID:28392145
|
| Other |
DMEM cell culture media |
Thermo Fisher Scientific |
Cat. #: 11965118 |
|
| Other |
M199 cell culture media |
Thermo Fisher Scientific |
Cat. #:11043023 |
|
| Other |
DMEM low glucose cell culture media, no phenol red |
Thermo Fisher Scientific |
Cat. #:11054020 |
|
| Other |
Lipofectamine 2000 |
Thermo Fisher Scientific |
Cat. #: 11668019 |
Transfection reagent |
