Skip to main content
. 2021 Oct 13;10:e69288. doi: 10.7554/eLife.69288

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background(Xenopus tropicalis, females) Wild-typeadult females Nasco LM00823
Strain, strain background(X. tropicalis, males) Wild-typeadult males Nasco LM00822
Strain, strain background(X. laevis, females) Wild-typeadult females Nasco LM00531
Strain, strain background(X. laevis, males) Wilt-typeadult males Nasco LM00715
Genetic reagent(X. tropicalis) Xtr.Tg(WntREs: dEGFP)Vlemx National Xenopus Resource (NXR) Center,Woods Hole, MA RRID:NXR_1094 X. tropicalis Wnt/Bcat reporter line
Genetic reagent(X. laevis) Xla.Tg(WntREs: dEGFP)Vlemx, NXR RRID:NXR_0064 X. laevis Wnt/Bcat reporter line
Genetic reagent(X. laevis) Xla.Tg.(nkx2-5:GFP)Mohun NXR RRID:NXR_0030 X. laevis Nkx2-5:GFP reporter line
Strain, strain background(Mus musculus) CD-1 Charles River Labs Strain Code022RRID:IMSR_CRL:022 WT mice
Genetic reagent(M. musculus) Shhtm1(EGFP/cre)Cjt Jax Labs JAX: 005622RRID:IMSR_JAX:005622 Shh:GFP mice
Cell line(M. musculus) Tbx5OE-mESC line Steimle et al., 2018 Steimle et al., 2018
Chemical compound, drug Doxycycline Sigma-Aldrich D9891
Antibody (Rabbit polyclonal) anti-Aldh1a2 Abcam ab96060, RRID:AB_10679336 IF (1:500)
Antibody (MouseMonoclonal)Anti-Aldh1/2 Santa Cruz Biotechnology sc-166362, RRID:AB_2009458 IF (1:500)
Antibody (Mouse monoclonal) anti-Sox2 Abcam ab79351; RRID:AB_10710406 IF (1:1000)
Antibody (Rabbit polyclonal) anti-Nkx2-1 (H-190) Santa CruzBiotechnology sc-13040X; RRID:AB_793532 IF (1:500)
Antibody (Mouse monoclonal) anti-Fibronectin (4H2) Developmental Studies Hybridoma Bank DSHB #4H2; RRID:AB_2721949 IF (1:2000)
Antibody (Chicken polyclonal) anti-GFP Aves Labs GFP-1020; RRID:AB_10000240 IF (1:1000)
Antibody (Goat polyclonal)anti-Tbx5 Santa Cruz Biotechnology sc-17866, RRID:AB_2200827 IF (1:300)ChIP: 5 µg
Recombinant DNA reagent pI-SceI-d2EGFP plasmid Addgene Addgene_32674 For meganuclease transgenics
Recombinant DNA reagent pRL-TK(plasmid) Promega E2241
Recombinant DNA reagent pGL4.23 luc2/miniP(plasmid) Promega E8411
Recombinant DNA reagent pCS2+ GR-xTbx5 Addgene Addgene 117248
Recombinant DNA reagent pCS2+ xTbx5 Addgene Addgene 117247
Recombinant DNA reagent pCSf107mT-Gateway-3′myc Addgene Addgene 67617
Recombinant DNA reagent pENTR223Human TBX5 Horizon Discovery OHS5894-202500411
Commercial assay or kit Gateway LR Clonase II enzyme mix Thermo Fisher Scientific 11791020
Commercial assay or kit mMessage mMachine SP6 RNA synthesis kit Thermo Fisher Scientific AM1340
Peptide, recombinant protein FGF8b R&D Systems 423-F8-025
Peptide, recombinant protein WNT2B R&D Systems 3900-WN-025
Commercial assay or kit TRIzol Thermo Fisher Scientific 15596018
Commercial assay or kit Direct-zolMiniprep plus kit Thermo Fisher Scientific R2070
Commercial assay or kit SuperscriptVILO mastermix Thermo Fisher Scientific 11755050
Commercial assay or kit PowerUP2× SYBR Green MasterMix Thermo Fisher Scientific A25742
Commercial assay or kit Firefly Luciferase 2.0 kit Biotium 30085-1
Commercial assay or kit Renilla Luciferase2.0 kit Biotium 30082-1
Chemical compound, drug DEAB Sigma-Aldrich D86256
Chemical compound, drug All-trans retinoic acid(RA) Sigma-Aldrich R2625
Chemical compound, drug Ketoconazole Tocris Tocris#1103
Chemical compound, drug Cycloheximide Sigma-Aldrich C4859
Chemical compound, drug Dexamethasone Sigma-Aldrich Sigma D4902
Peptide, recombinant protein CAS9 PNA Bio CP01-20
Sequence-based reagent X. tropicalis tbx5 exon5 sgRNA IDT DNA GGGGTTCTGATATGAAGTGA Steimle et al., 2018
Sequence-based reagent X. laevis Tbx5 MO1 GeneTools 5′-TTA GGA AAG TGT CTC TGG TGT TGC C -3′; Brown et al., 2005
Sequence-based reagent X. laevis Tbx5 3 bp mismistach MO1 GeneTools 5′-TCA GTA AAG TAT CTC TGG TGT TGC C-3′ This paper
Sequence-based reagent X. laevis Tbx5 MO2 GeneTools 5′-CAT AAG CCT CCT CTG TGT CCG CCA T-3 Brown et al., 2005
Sequence-based reagent X. laevis Tbx5 3 bp mismatch MO2 GeneTools 5′-TAT CAG ACT CCT CTG TGT CCG CCA T-3′ This paper
Sequence-based reagent X. laevis Aldh1a2-MO GeneTools 5′-GCA TCT CTA TTT TAC TGG AAG TCAT-3′ Strate et al., 2009
Sequence-based reagent X. laevis Cyp26a1-MO GeneTools 5′-TAG TGA GCA GAG TAT ACA GAT CCA T-3′ Janesick et al., 2013
Sequence-based reagent X. laevis Cyp26c1-MO GeneTools 5′-TAC AAG ATG TTC CTC CTT GAG ATC A-3′ Yu et al., 2016
Commercial assay, kit Protein G-conjugated magnetic beads Life Technologies 1,003D
Commercial assay, kit NEBNext Ultra DNA Library Prep Kit New England Biolabs E7370S
Commercial assay, kit Sera-Mag magnetic beads GE 6515-2105-050-250
Software, algorithm Morpheus Broad Institute https://software.broadinstitute.org/morpheusRRID:SCR_017386
Commercial assay, kit SceI mega-nuclease enzyme New England Biolabs R0694S Use within 1 month of purchase, store at –80°C
Commercial assay, kit Dispase Corning Life Sciences 354235 Use at 10 U/ml on Xenopus explants