Reagent/Resource	Reference or source	Identifier or catalog number
Experimental Models
C57BL/6J (M. musculus)	Jackson Lab	B6.129P2Gpr37tm1Dgen/J
Nrl.gfp (M. musculus)	Kind gift of Dr Anand Swaroop, now available through Jackson Lab	B6. Cg‐Tg(Nrl‐EGFP)1Asw/J
Ai9(RCL‐tdT) or TdTomato (M. musculus)	Jackson Lab	B6. Cg‐Gt(ROSA)26Sortm9(CAG‐tdTomato)Hze/J
mTmG or myrRFP (M. musculus)	Jackson Lab	Gt(ROSA)26Sortm4(ACTB‐tdTomato,‐EGFP)Luo/J
Gnat1−/− (M. musculus)	kind gift of Dr Janis Lem, Tufts Medical College	Gnat1−/−; Gnat1KO
Nrl.Cre (M. musculus)	Jackson Lab	C57BL/6J‐Tg(Nrl‐cre)1Smgc/J
Recombinant DNA
Pd10.Nrl.Cre	This paper, based on Akimoto et al, 2006 and Brightman et al, 2016 sequences	N/A
AAVPk	Addgene	N/A
pHGTI helper	Plasmid factory	PF1810
pLenti‐CAG‐GFP‐P2A	Generated by Dr Ortín‐Martínez Arturo and Professor Valerie Wallace, University of Toronto	N/A
pLenti‐CAG‐RhoA‐GFP‐P2A	Generated by Dr Ortín‐Martínez Arturo and Professor Valerie Wallace, University of Toronto	N/A
pLenti‐CAG‐ΔNRac‐GFP‐P2A	Generated by Dr Ortín‐Martínez Arturo and Professor Valerie Wallace, University of Toronto	N/A
pMD2.G	Addgene	N/A
pCMVΔR8.74	Addgene	N/A
Antibodies
CD81	Cell Signalling	10037
TSG101	BD Transd	612696
CD9	EDM Millipore	CBL162
Alix	Cell Signalling	2171
Cre recomb	EDM Millipore	MAB3120
GM130	Cell Signalling	12480
Opsin	Sigma	O4886
G‐alpha‐t1	Santa Cruz INC	Sc389
Recoverin	MERCK	AB5585
GFP/CFP/RFP	Clontech	632380
Anti‐LAMP1	Abcam	[1D4B] (ab25245)
Beta actin	R&D Systems	MAB8929
Beta actin	Sigma	A2228
Rac	Cytoskeleton Inc	ARC03‐S
RhoA	Cell Signaling	(67B9) Rabbit mAb #2117
CD73 APC	Miltenyl	130‐103‐052
Oligonucleotides and sequence‐based reagents
rtQPCR primers	This study	Expanded View‐ Materials and Methods
Gfp: GAAGCGCGATGACATGGT/CCATGCCGAGAGTGATCC/ probe 67	This study	Expanded View‐ Materials and Methods
Cre: ATCTGGCATTTCTGGGGATTG/ GCAACACCATTTTTTCTGACCC/ probe 20	This study	Expanded View‐ Materials and Methods
Gnat1: AGAGCTGGAGAAGAAGCTGAAA/ TAGTGCTCTTCCCGGATTCA/ probe 89	This study	Expanded View‐ Materials and Methods
Rcvrn: CAATGGGACCATCAGCAAA/ CCTCAGGCTTGATCATTTTGA/ probe 67	This study	Expanded View‐ Materials and Methods
Rho: ACCTGGATCATGGCGTT/ TGCCCTCAGGGATGTACC/probe 32	This study	Expanded View‐ Materials and Methods
Crx: CCCCAATGTGGACCTGAT/GGCTCCTGGTGAATGTGGT/ probe 64	This study	Expanded View‐ Materials and Methods
Nrl; TTCTGGTTCTGACAGTGACTACG/ TGGGACTGAGCAGAGAGAGG/ probe 53	This study	Expanded View‐ Materials and Methods
Actb:AAGGCCAACCGTGAAAAGAT/GTGGTACGACCAGAGGCATAC/probe 56	This study	Expanded View‐ Materials and Methods
Chemicals, enzymes and other reagents
RNase	Sigma
Super RNAse Out 20 U/µl,	Thermo Fisher
TaqMan® Universal PCR Master Mix	Roche UK
FAM RTQPCR probe	Universal Probe Library; Roche, Germany
Mitotracker‐Orange	(Invitrogen/Molecular Probes, M7512)
SiR‐actin	Cytoskeleton
SiR‐tubulin	Cytoskeleton
SiR700‐lysosome	Cytoskeleton
verapamil	Cytoskeleton
DiI or DiO lipophilic tracers	Thermo Fisher
Cytochalasin D	Sigma
ROCK inhibitor Y‐27632	Sigma
Latrunculin B	Sigma
Fibronectin	Sigma
Poly‐D‐lysine hydrobromide	Sigma
Software
GraphPad Prism 8	GraphPad
Adobe Photoshop version 22.4	Adobe
Image J (FIJI)	NIH
HyVolution software (Scientific Volume Imaging Huygens)	Scientific Volume Imaging
LEICA LASX	Leica
Chemidoc‐Gel Lab	Bio‐Rad
Fast Real‐time Sequence Detection System (Applied Bioscience, USA)	Applied Bioscience
Other
QuantiTect® Whole Transcriptome	Qiagen
Qiagen RNeasy® Mini kit	Qiagen
Immobilon™ Western Chemiluminescent HRP substrate kit	Millipore, USA
CD73 APC and anti APC microbeads and magnetic rack	Miltenyl
Worthington Papain Dissociation System	Worthington Biochemical Corporation, USA